You are here

Home » Strain DB

Animal Strain view

ACRC Stock ID_2 Strain ID Full Scientific Strain Name Repository Status Stock Status Species Strain Type Lab of Origin Original Stock ID Genetic background Suggested Breeding Scheme (f)X(m) Eye/Coat Colour Information On Strain Specifics Genotype litters required Date Of Import Number of (f) and (m) Imported MTA ID Notes
acrc:21000001 129X1 129X1/SvJNcbs Public Cryo-S Mus Musculus WT JAX -> JNcbs JAX# 000691 inbred (sibling X sibling) pink-eyed, light-bellied, light chinchilla 6-9 pups per litter N = old stock imported in 2013 or prior - Filiation unknown Global JAX/NCBS/Instem transfer agreements_2017 = old stock imported in 2013 or prior - Filiation unknown- [old ID = acrc:00001]
acrc:21000398 ACE2 KO1- exon2Del [B6ND2] B6N;DBA2-Ace2 em1Mgef/Blisc (g52-ATGexon2 deletion) Public Live, Cryo-S Mus Musculus KO - crispr/cas Targeted deletion MGEF / BLiSC B6NJ/Ncbs -2017 BLiSC- ACRC Crispr/Cas targeted exon2 deletion- please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000397 ACE2 KO2 [B6ND2] B6N;DBA2-Ace2em2Mgef/Blisc for the (g52-g55 47Kb deletion) Public Cryo-S Mus Musculus KO - crispr/cas Targeted deletion MGEF / BLiSC B6ND2 being backcrossed on B6/NJNcbs backrground Saturday, August 1, 2020 BLiSC- ACRC Crispr/Cas targeted full gene deletion- mouse model developed at MGEF/ BLiSC facility- in the process of being characterised / analysed and stock amplified- Stock ready for pre-order- Please NOTE that we have also generated a knock-IN humanized hACE2 KI strain and several K18-hACE2 transgenic lines- -search for " ACE2 " in the "Strain Name" search field of this database for more details- please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000245 Adipoq-CreER B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs Public Live, Cryo-S Mus Musculus Transgenic (Inducible, Recombinase-expressing) JAX -> JNcbs JAX# 24671 B6 Hemizygote x Noncarrier OR Noncarrier x Hemizygote black Wednesday, February 21, 2018 2 (Noncarrier X Hemi) breeding pairs Global JAX/NCBS/Instem transfer agreements_2017, SRD [old ID = acrc:00011]
acrc:21000434 Adipoq-CreER, tdT, Rag1KO B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT), B6.129S7-Rag1tm1Mom/JNcbs Public Live, Cryo-S Mus Musculus compound JAX-> ACRC compound of JAX# 24671 and JAX# 007914 and Jax# 002216 mixed Global JAX/NCBS/Instem transfer agreements_2017
acrc:21000310 Ai9/Ai9; Lhx2cKO/ Lhx2cKO Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/Ncbs ; Lhx2tm1Monu/Ncbs Public Live, Cryo-S Mus Musculus coumpound, cKO Shubha Tole (TIFR Mumbai) Cryo + JAX compound from JAX#007909 + MGI:3772179 mixed - original Cryo males were agouti Tuesday, November 22, 2016 Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX, BM BM - imported new set of animals for rederivation and cryo from TIFRmumbai 6 March 2021.
acrc:21000252 Ai95D B6;129SGt(ROSA)26Sor<tm95.1(CAGGCaMP6f)Hze>/JNcbs Public Live, Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), No functional change, Reporter) JAX -> JNcbs JAX# 24105 mixed B6;129 Heterozygote x Wild-type OR Wild-type x Heterozygote Black Wednesday, February 21, 2018 2 (HET X WT) breeding pairs Global JAX/NCBS/Instem transfer agreements_2017, GH [old stock ID =acrc:00012]
acrc:21000337 Ai95D Flox/+, Stim1 Flox/+ B6;129SGt(ROSA)26Sor<tm95.1(CAGGCaMP6f)Hze>/JNcbs , Stim1^tm1Rao/Ncbs Public Cryo-S Mus Musculus Anjana Rao Lab, La Jolla Institute (CA), JAX compound from JAX# 24105 and MGI:3778911 Anjana Rao Lab, La Jolla Institute (CA), JAX
acrc:24000048 Alb-Cre B6N.Cg-Speer6-ps1/J<Tg(Alb-Cre)21Mgn/J Public Live, Cryo-S Mus Musculus ULLAS_TIFR HYD Stock - 018961 B6N/J
acrc:21000190 aMHC-PARP1 B6;D2-Tg(AlphaMHC-humPARP1)1/Ncbs Public Live, Cryo-S Mus Musculus Transgenic, Random Insertion MGEF_DP MGEF B6D2-F2/JNcbs needs to be backcrossed to C57BL/6J YES Wednesday, November 9, 2016 only 1 Founder animal (#26) NCBS/INSTEM_MGEF MTA1, MGEF / DP [old stock ID=MGEF:00001].. MGEF_DP_ microinjection Project 2016- injected in B6D2F2 oocytes- Overexpression of Human PARP1 under alphaMHC promotor- Cardiac phenotype observed- genotyping (300bp amplicon)= Alpha MHC Fw: TACATGGAGTCCTGGTGGGA ; hPARP1 RV3: CATCAAACATGGGCGACTGC
acrc:21000331 ANT2lox STOCK Slc25a5tm1.1Nte ?? Ant2 floxed Public Live, Cryo-S Mus Musculus Targetted KI Cryo for Ullas Kolthur - TIFRmumbai - JAX Is this JAX#029482 ? C57BL6/EiJ Tuesday, January 10, 2017 Ullas Kolthur - TIFRmumbai for CryoStocks, JAX original Stock ID to be clarified
acrc:21000295 Ascl1-CreERT2 STOCK Ascl1tm1.1(Cre/ERT2)Jejo/JNcbs Public Live, Cryo-S Mus Musculus targeted mutation JAX ->NCBS JAX# 12882 mixed (129S6/SvEvTac; C57BL/6 ; ICR outbred) recommended: Heterozygote x +/+ WT sibling mixed - albino to black Homozygotes die within hours of birth due to CNS and PNS disruptions in neural development Thursday, September 20, 2018 2 Heterozygote males Global JAX/NCBS/Instem transfer agreements_2017 [old Stock ID=acrc:00014]
acrc:21000390 Asrij KO#13 Asrij KO#13 (= Ociad1 KO #13) Public Cryo-S Mus Musculus JNCASR - MI Mixed strain: C57BL/6N × CBA Wednesday, January 8, 2020 homozygote male donors RIKEN - CDB, ACRC - JNCSAR -Maneesha Inamdar Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000391 Asrij KO#16 Asrij KO#16 (= Ociad1 KO #16) Public Cryo-S Mus Musculus JNCASR - MI Monday, July 1, 2019 homozygote male donors RIKEN - CDB, ACRC - JNCSAR -Maneesha Inamdar Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000392 Asrij KO#59 Asrij KO#59 (= Ociad1 KO #59) Public Live, Cryo-S Mus Musculus JNCASR - MI Monday, July 1, 2019 homozygote male donors RIKEN - CDB, ACRC - JNCSAR -Maneesha Inamdar Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000071 Asrij Lox #13 Asrij Lox #13 (= Ociad1 Lox #13) Public Cryo-S Mus Musculus RIKEN-> Ncbs original: C57BL/6 × CBA Homozygote X Homozygote black/agouti Riken, Ncbs, Prof. Maneesha Inamdar Stock Cryopreserved for Maneesha Inamdar (JNCSAR). [old Stock ID=acrc:00015]
acrc:21000114 Asrij Lox #16 Asrij Lox #16 (= Ociad1 Lox #16) Public Cryo-S Mus Musculus RIKEN -> Ncbs original: C57BL/6 × CBA (transgenic) Homozygote x Homozygote black/agouti Riken, Ncbs, Prof. Maneesha Inamdar [old stock ID = acrc:00016]
acrc:21000112 Asrij Lox #59 Asrij Lox #59 (= Ociad1 Lox #59) Public Live, Cryo-S Mus Musculus RIKEN -> Ncbs original: C57BL/6 × CBA (transgenic) Homozygote x Homozygote black/agouti Prof. Maneesha Inamdar (JNCASR & inStem) Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000195 Axin2-d2EGFP Tg(Axin2-d2EGFP)5Cos/Ncbs Public Live, Cryo-S Mus Musculus Transgenic-Reporter, Random Insertion Frank Costantini, Columbia University- (NCBS Rederived from Shubha Tole-Mumbai TIFR, Aug2016) MGI:3836891 mixed 13 pups per litter at TIFR-Mumbai; NCBS=? Friday, August 12, 2016 Rederived via embryo Transfer from Shubha Tole-TIFR Mumbai- Stocks - From Frank Costantini, Columbia University, Shubha Tole (TIFRmumbai) for cryo stock MTA: Frank Costantini, Columbia University & Ramkumar Sambasivan direct Agreement-
acrc:21000369 B2m KO B6.129P2-B2mtm1Unc/DcrJNcbs Public Live, Cryo-S Mus Musculus Targeted (Null/Knockout) JAX JAX#002087 Homozygote x Homozygote black Friday, September 13, 2019 2 breeding pairs JAX to TIFRHyd TIFRHyd
acrc:21000311 B5/EGFP FVB.Cg-Tg(GFPU)5Nagy Public Cryo-S Mus Musculus Transgenic (Reporter) cryo for Shubha Tole (TIFR Mumbai) + JAX JAX#003516 Tuesday, November 22, 2016 Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX
acrc:21000249 B6 PVcre B6.129P2Pvalb<tm1(cre)Arbr>/JNcbs Public Live, Cryo-S Mus Musculus Targeted (Recombinase-expressing) JAX JAX# 17320 B6 HOMO X HOMO Black parvalbumin is expressed in sperm; use of male PV-Cre mice may result in unwanted germline recombination and global recombination. preferable to check genotype of breeders Wednesday, February 21, 2018 2 (HOMO X HOMO) Breeding Pairs JAX JAX- When maintaining a live colony, these mice can be bred as homozygotes. Of note: parvalbumin is expressed in sperm; use of male PV-Cre mice may result in unwanted germline recombination and global recombination. USB
acrc:21000004 B6/J C57BL/6JNcbs Public Cryo-E, Cryo-S Mus Musculus WT JAX -> JNcbs JAX# 000664 ______________________________ inbred siblings (C57BL/6J X C57BL/6J) __________________ black ____________________________________________ average litter size of 6-8 pups after the 2nd litter. Almost systematic cannibalism of the first litter and frequent cannibalism of subsequent litters - Around 50% male /female ratio in litters N = old stock imported in 2013 - Filiation unknown Global JAX/NCBS/Instem transfer agreements_2017 = old stock Imported in 2013. [old ID = acrc:00002]
acrc:21000238 B6/J_2017 C57BL/6JNcbs_2017 Public Live, Cryo-E, Cryo-O, Cryo-S Mus Musculus inbred JAX -> JNcbs JAX#000664 B6/J_2017 Wednesday, September 13, 2017 4 breeding pairs Global JAX/NCBS/Instem transfer agreements_2017 Sept 2017 = B6/J_2017 = newly imported stocks different from OLD stock (= B6/J). [old ID=acrc:00008]
acrc:21000368 B6/J_2019 C57BL/6JNcbs [2019] Public Live, Cryo-S Mus Musculus JAX JAX#000664 Friday, September 13, 2019 2 breeding pairs JAX to TIFRHyd
acrc:21000363 B6J albino B6(Cg)-Tyrc-2J/JNcbs Public Live, Cryo-E, Cryo-S Mus Musculus JAX JAX#000058 B6J Homozygote X Homozygote albino / white Friday, September 13, 2019 3 breeding pairs JAX B6(Cg)-Tyrc-2J/J, or B6-albino mice, are C57BL/6J mice that carry a mutation in the tyrosinase gene. Pigment is completely absent from skin, hair and eyes in mice homozygous for Tyrc-2J. This unique characteristic makes these mice ideal for creation of novel strains with targeted mutations (gene knockouts) on the B6J background.
acrc:24000053 B6N22 D2/21 F1 B6N22 D2/21 F1 Public Live, Cryo-S Mus Musculus wild type hybrid MGEF B6N/J *DBA/2 B6N/J *DBA/2
acrc:21000441 B6NJ_2020 C57BL/6NJNcbs [2020] Public Live, Cryo-E, Cryo-S Mus Musculus inbred JAX JAX#005304 B6N inbred black no but genetic monitoring recommended Friday, November 27, 2020 6 breeding pairs JAX
acrc:21000507 BALB/cJ_2021 BALB/cJNcbs [2021] Public Live, Cryo-E, Cryo-S Mus Musculus JAX JAX # 000651 Thursday, June 24, 2021 4 breeding pairs JAX
acrc:21000254 BALBc_2018 BALB/cJNcbs [2018] Public Cryo-S, Discontinued Mus Musculus WT JAX JAX # 651 inbred (sibling X sibling) albino white no Wednesday, February 21, 2018 3 breeding pairs JAX @JAX- BALB/cJ Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).
acrc:21000057 beta1Flox B6;129-Itgb1tm1Efu/JNcbs (integrin beta 1 (fibronectin receptor beta) Public Cryo-S Mus Musculus targeted JAX -> JNcbs JAX# 004605 B6;129 Homozygote x Homozygote Agouti / dark brown 8-12 pups per litter No Global JAX/NCBS/Instem transfer agreements_2017, SR [old stock ID = acrc:00006]
acrc:21000149 beta1Flox, K14Cre (CD1) beta1^flox/flox, K14Cre (CD1) Public Cryo-S Mus Musculus SR
acrc:21000187 betaCat-Flox B6.129-Ctnnb1tm2Kem/Ncbs (beta-Catenin cKO) Public Live, Cryo-S Mus Musculus Knockin, conditional knock-out Rolf Kemler, MPI-IE Freiburg (NCBS imported via Shubha Tole-TIFR Mumbai) MGI:2148567 also available as JAX: 004152 mixed 13 pups per litter at TIFR-Mumbai; NCBS=? Friday, August 12, 2016 Rederived via embryo Transfer from Shubha Tole-TIFR Mumbai- Stocks Rolf Kemler, MPI-IE Freiburg and Ramkumar Sambasivan direct agreement, Shubha Tole (TIFRmumbai) for cryo stock MTA: Rolf Kemler, MPI-IE Freiburg and Ramkumar Sambasivan direct agreement- ST-CryoStocks. [old stock ID=acrc:00007]
acrc:21000196 betaCat-loxEx3 Ctnn1b tm1Mmt (beta-Catenin GOF) Public Live, Cryo-S Mus Musculus Knockin, conditional Gain of function Makoto Mark Taketo, Kyoto University (NCBS imported via Shubha Tole-TIFR Mumbai) MGI:1858008 mixed 16 pups/litter at TIFR Mumbai - NCBS=? Friday, August 12, 2016 Rederived via embryo Transfer from Shubha Tole-TIFR Mumbai- Stocks Makoto Mark Taketo, Kyoto University, Shubha Tole (TIFRmumbai) for cryo stock MTA: Makoto Mark Taketo, Kyoto University and Ramkumar Sambasivan direct agreement-
acrc:21000389 c-met flox FVB;129P2-Mettm1Sst Public Cryo-E, Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), No functional change) JAX -> RCB -> ACRC JAX#016974 mixed - backcrossed on FVB/NJ JAX, Masum Saini (Regional Centre for Biotechnology, NCR Delhi) From Masum Saini (Regional Centre for Biotechnology, NCR Delhi) - 2019 - for Cryo and Rescue as original imported breeder were not breeding well at all.
acrc:21000372 C3HFe C3HeB/FeJNcbs [2019] Public Cryo-E, Cryo-S Mus Musculus JAX JAX#000658 inbred- Sibling x Sibling agouti Friday, September 13, 2019 2 breeding pairs JAX This general purpose strain shares a common origin with C3H/HeJ and C3H/HeOuJ. Unlike C3H/HeJ, it carries a normal allele at the Tlr4 locus, but is homozygous for Pde6brd1, which causes retinal degeneration. C3HeB/FeJ inbred mice have been found to be extremely susceptible to virulent Mycobacterium tuberculosis. They develop pulmonary tuberculosis and die within 25-28 days of infection with 105 CFU of Erdman strain of M. tuberculosis (Kramnik et al, 1998). Several QTL have been identified that contribute to the M. tuberculosis susceptibility (Sissons et al., 2009)
acrc:21000063 CamK2 B6.Cg-Tg(Camk2a-cre)T29-1Stl/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Transgenic JAX -> JNcbs JAX# 005359 inbred (sibling X sibling) (f)CamK2 X (m)CamK2 black litter size 5-10 pups N 2 duos Global JAX/NCBS/Instem transfer agreements_2017, USB New stocks arrived on 9th August 2022.
acrc:21000128 CaMK2a-CreERT2 [MxP] B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs/JNcbs Public Cryo-S Mus Musculus Transgenic (Inducible, Recombinase-expressing) cryo stocks from MPI (Dresden)-> NCBS JAX# 012362 B6 Hemizygote x Noncarrier JAX cryo stocks from MCI (Ronald - Dresden)-- The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the MaxPlank CaMK2a-CreERT2 allele.
acrc:21000560 CaMK2a-CreERT2 [MxP], E2-2f, TRAP B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [MxP], Tcf4tm1.1Hmb; B6.129S4Gt(ROSA)26Sor<tm1(CAGEGFP/Rpl10a birA)Wtp>/JNcbs -[R26fsTRAP] Public Live, Cryo-S Mus Musculus JAX and Dan Holmberg (Sweden) components of JAX# 012362 and MGI:3798811+ JAX#22367 mixed JAX, Dan Holmberg (Sweden) The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the MaxPlank CaMK2a-CreERT2 allele.
acrc:21000569 CaMK2a-CreERT2 [MxP], E2-2f/f, RCE B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [MxP], E2-2f [Tcf4tm1.1Hmb], Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] /Ncbs Public Live, Cryo-S Mus Musculus JAX and Dan Holmberg (Sweden) and Gordon Fishell (NY) components of JAX# 012362 and MGI:3798811+ JAX#32038 (or MGI:4420764) JAX, Dan Holmberg (Sweden) The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the Max Plank (MxP) CaMK2a-CreERT2 allele.
acrc:21000559 CaMK2a-CreERT2 [NY], E2-2f/f, RCE B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [NY], E2-2f [Tcf4tm1.1Hmb], Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] /Ncbs Public Live, Cryo-S Mus Musculus JAX and Dan Holmberg (Sweden) and Gordon Fishell (NY) components of JAX# 012362 and MGI:3798811+ JAX#32038 (or MGI:4420764) mixed JAX, Dan Holmberg (Sweden) The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the NY CaMK2a-CreERT2 allele.
acrc:21000223 CaMK2a-CreERT2 [NY], E2-2f/f, Thy1-GFP lineM;R26-Stop-fl-Ai9-tdTomato B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs/JNcbs [NY], Tcf4tm1.1Hmb (E2-2-)/Ncbs, STOCK Tg(Thy1-EGFP)MJrs/JNcbs [Thy1-GFP line M];B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)] Public Live, Cryo-S Mus Musculus compound JAX and Dan Holmberg (Sweden) components of JAX# 012362 and MGI:3798811 and JAX#007788 mixed Global JAX/NCBS/Instem transfer agreements_2017, Dan Holmberg (Sweden) The Thy1-EGFP allele was recovered from IISC stocks- most likely: STOCK Tg(Thy1-EGFP)MJrs/J [Thy1-GFP line M]-- The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the NY CaMK2a-CreERT2 allele.
acrc:21000470 CaMK2a-CreERT2, E2-2, RCE B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs, E2-2f [Tcf4tm1.1Hmb], Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] /Ncbs Public Cryo-S Mus Musculus JAX and Dan Holmberg (Sweden) and Gordon Fishell (NY) components of JAX# 012362 and MGI:3798811+ JAX#32038 (or MGI:4420764) mixed JAX, Dan Holmberg (Sweden)
acrc:21000090 Cas9 (Rosa26) STOCK Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/JNcbs (constitutive Rosa26-Cas9 knockin) Public Cryo-S Mus Musculus KI -Targeted (Inserted expressed sequence, Reporter) JAX JAX# 024858 mixed (B6N , 129 , B6J and maybe FVB/N) Homozygote x Homozygote OR Homozygote x Inbred and recip black Y Thursday, January 14, 2016 2 breeding pairs (homozygotes littermates DOB- 29 Dec 2015) Global JAX/NCBS/Instem transfer agreements_2017 _______________________________________________________________________ MGEF- need to backcross on B6/J JAX<The construct was electroporated into 129-derived R1 embryonic stem (ES) cells. Correctly targeted ES cells were injected into C57BL6/N blastocysts. The resulting chimeric animals were tested for germline transmission by crossing to C57BL/6N mice. The mice were then crossed to a beta-actin driven Cre recombinase strain (FVB/N) (Stock No. 003376) to excise the floxed STOP cassette. Upon arrival at The Jackson Laboratory, the mice were crossed to C57BL/6J (Stock No. 000664) at least once to establish the colony.>
acrc:21000192 Casp1-/- B6N.129S2-Casp1tm1Flv/JNcbs [ICE] Public Live, Cryo-S Mus Musculus JAX-> JamoraLab-> ACRC JAX#016621 JAX CJ-- This strain, relevant to studies of inflammation and cell death, carries a knockout allele of the Casp1 gene as well as an incidental Casp4 deficiency.
acrc:21000234 CBA/J_2017 CBA/JNcbs [2017] Public Live, Cryo-E, Cryo-S Mus Musculus JAX JAX#000656 inbred agouti This strain is homozygous for the retinal degeneration allele Pde6b-rd1, which causes blindness by wean age. Wednesday, September 13, 2017 2 breeding pairs JAX JAX notes: CBA/J strain carries the Pde6brd1 mutation, which causes blindness by wean age. Renal tubulointerstitial lesions have been observed in this strain at a high frequency. Some CBA/J mice spontaneously develop exocrine pancreatic insufficiency syndrome.
acrc:21000505 CBA_2021 CBA/JNcbs [2021] Public Live, Cryo-E, Cryo-S Mus Musculus JAX JAX#000656 Thursday, June 24, 2021 2 breeding pairs JAX
acrc:21000110 CBF:H2B-Venus [2018] STOCK Tg(Cp-HIST1H2BB/Venus)47Hadj/JNcbs Public Cryo-S Mus Musculus Transgenic JAX ->NCBS JAX# 020942 originally generated on FVB Hemizygote x Noncarrier or Noncarrier x Hemizygote albino Thursday, September 20, 2018 1 breeding pair (Hemizygoytes) JAX
acrc:23000030 Ccdc11(Cfap53) Ccdc11(Cfap53)-[RIKEN] Public Cryo-S Mus Musculus Ccdc11(Cfap53) RIKEN (CDB0210E) Monday, April 3, 2023 Imported 2 straws of Sperms
acrc:21000353 CD1-2019 Crl: CD1 (IGS) Elite Public Live, Cryo-E, Cryo-S Mus Musculus Charles River USA Crl:022 - Elite SPF mini Outbred albino Thursday, May 30, 2019 5 breeding pairs from Crl USA via Hyalasco Crl USA
acrc:21000393 CD45.2 ; Ly5.2 CD45.2 ; Ly5.2 Public Cryo-S Mus Musculus JNCASR - MI -> initially imported from NII, Delhi - Dr. Asok Mukhopadhyay-(retired) ?? to be checked and verified ??, Maneesha Inamdar (JNCSAR) Stock Cryopreserved for Maneesha Inamdar (JNCSAR) but initially imported to JNCSAR from from NII, Delhi - Dr. Asok Mukhopadhyay (retired)-
acrc:21000005 CD4Cre, Notch1loxP CD4Cre, Notch1lox/lox Public Live, Cryo-S Mus Musculus Tg, Targeted KO Freddy Radtke EPFL B6 Notch1lox/lox (F) X CD4Cre+, Notch1lox/lox (M) black Y Freddy Radtke EPFL AS
acrc:21000007 CD4Cre, RaploxP CD4Cre, Raptor lox/lox Public Live, Cryo-S Mus Musculus Targeted KO JAX and Freddy Radtke (EPFL) for the CD4 allele components of JAX#013188 and ? B6 Raptor lox/lox (F) X CD4Cre +ve, Raptor lox/lox (M) black Y AS
acrc:21000352 CF1_2019 Crl:CF1 - SPF Public Live, Cryo-S Mus Musculus Charles River USA Crl:023 mini outbred albino Thursday, May 30, 2019 5 breeding pairs from Crl USA via Hyalasco Crl USA
acrc:21000333 CMV-cre_TIFRm B6.C-Tg(CMV-cre)1Cgn Public Cryo-S Mus Musculus Transgene overexpression Cryo for Ullas Kolthur - TIFRmumbai - JAX JAX#006054 C57BL6/J Thursday, November 3, 2016 Ullas Kolthur for CryoStocks, JAX JAX: The transgene appears to be X-linked since transgene transmission through males is restricted to female offspring.
acrc:21000129 CMVCre B6.C-Tg(CMV-cre)1Cgn/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Transgenic (Recombinase-expressing) JAX JAX# 006054 Homozygote x Hemizygote (Transgene appears to be X-linked) black Y 4 males + 4 females (26-Feb-2009) Global JAX/NCBS/Instem transfer agreements_2017 Stock Cryopreserved for Maneesha Inamdar (JNCSAR). - JAX: The transgene appears to be X-linked since transgene transmission through males is restricted to female offspring.
acrc:21000297 Cor1a B6.129-Coro1Atm1Jpie/JNcbs Public Live, Cryo-S Mus Musculus congenic ; Targeted Mutation (Reporter, Null/Knockout) JAX ->NCBS JAX# 030203 B6 Homo X Homo or Homo X Het black Cor1-/- mice lack naive T cells in the periphery Thursday, September 20, 2018 1 Breeding pair (homozygous nul) Global JAX/NCBS/Instem transfer agreements_2017 Cor1-/- mice lack naive T cells in the periphery and show cognitive and behavioral disfunction. EGFP immunofluorescence is observed by direct visualization in these mice.
acrc:21000437 Csf1r Flox B6.Cg-Csf1rtm1.2Jwp Public Live, Cryo-S Mus Musculus Imported from IISC - originally a JAX stock JAX#021212 B6 Wednesday, November 18, 2020 JAX relocation MTA 3 males imported from IISC [Narendrakumar Ramanan] - rederived at MGEF- for SR lab.
acrc:21000454 Dach1-flox Dach1-flox Public Cryo-S Mus Musculus Kristy Red-Horse, Stanford University originally from KOMP repository mixed (FVBN , CD1) ??? to double check - because animals are black black Tuesday, December 15, 2020 2 females Red-Horse Lab - Stanford University, KOMP imported by Soumyashree Das from Standford University.
acrc:21000237 db/+_2018 BKS.CgDock7< m> +/+ Lepr<db>/J Ncbs Public Live, Cryo-E, Cryo-S Mus Musculus Diabetic model - double mutant - spontaneous mutations JAX JAX#000642 BKS Het X Het (db phenotype is background specific) Leprdb= black, fat; Related Genotype: a/a + Leprdb/+ Leprdb ; Dock7m Leprdb= black, lean; Related Genotype: a/a Dock7m +/+ Leprdb; Dock7m= misty (grey), lean; Related Genotype: a/a Dock7m +/Dock7m + Wednesday, February 21, 2018 1 breeding pair - Male died before breeding! + 2 new breeding pairs in Feb2018 Global JAX/NCBS/Instem transfer agreements_2017 September 2017: 1 breeding pair was imported and quarantined. when setting up mating after quarantine- a small protrusion was observed in the sternum region- the Male died with severe Ascites phenotype a few days later- Female is fine. 2 New Breeding pairs (2M+2F) imported in Feb2018.
acrc:21000487 DBA1 DBA/1JNcbs Public Live, Cryo-E, Cryo-S Mus Musculus inbred JAX -> NCBS JAX# 000670 Thursday, April 15, 2021 2 breeding pairs JAX DBA/1J mice are widely used as a model for rheumatoid arthritis: immunization with type II collagen leads to the development of severe polyarthritis mediated by an autoimmune response. DBA/1J mice show an intermediate susceptibility to developing atherosclerotic aortic lesions on an atherogenic diet. In response to challenge, DBA/1J mice develop immune-mediated nephritis characterized by proteinuria, glomerulonephritis and tubulointerstitial disease.
acrc:21000067 DBA2 DBA/2JNcbs Public Cryo-S Mus Musculus WT JAX JAX# 000671 inbred (sibling X sibling) dilute brown = old stock imported in 2013 or prior - Filiation unknown = old stock imported in 2013 or prior - Filiation unknown JAX: DBA/2J is a widely used inbred strain. Some characteristics include low susceptibility to developing atherosclerotic aortic lesions, high-frequency hearing loss, susceptibility to audiogenic seizures, development of progressive eye abnormalities that closely mimic human hereditary glaucoma, and extreme intolerance to alcohol and morphine.
acrc:21000256 DBA2_2018 DBA/2JNcbs [2018] Public Live, Cryo-S Mus Musculus WT JAX JAX# 000671 inbred (sibling X sibling) dilute brown hearing loss NO Wednesday, February 21, 2018 3 breeding pairs Global JAX/NCBS/Instem transfer agreements_2017 @JAX -DBA/2J is a widely used inbred strain. Some characteristics include low susceptibility to developing atherosclerotic aortic lesions, high-frequency hearing loss, susceptibility to audiogenic seizures, development of progressive eye abnormalities that closely mimic human hereditary glaucoma, and extreme intolerance to alcohol and morphine.
acrc:21000506 DBA2_2021 DBA/2JNcbs [2021] Public Live, Cryo-E, Cryo-S Mus Musculus JAX JAX# 000671 Thursday, June 24, 2021 4 breeding pairs JAX
acrc:21000525 DCX CreERT2; E2-2f; R26fsTRAP Dcx_CreERT2-UTR_TG_04; Tcf4tm1.1Hmb; B6.129S4Gt(ROSA)26Sor<tm1(CAGEGFP/Rpl10a birA)Wtp>/JNcbs -[R26fsTRAP] Public Cryo-S Mus Musculus compound DCXallele from Wolfgang Wurst; JAX and Dan Holmberg (Sweden) JAX# 22367; MGI:3798811 E2-2 = Dan Holmberg (Sweden), R26fsTRAP = JAX, CryoStock = HSG, DCXCre from Prof. Wolfgang Wurst / German Research Center for Environmental Health REF for DCXCreER Allele: BMC Neurosci. 11:158. doi: 10.1186/1471-2202- 11-158
acrc:23000029 Dtd1 and Dtd2 Dtd1 and Dtd2[RIKEN] Public Cryo-E, Cryo-S Mus Musculus RIKEN (CDB0297E &CDB0298E) C57BL/6N*+/- Monday, April 3, 2023 Imported 3 vials of embryos and 4 straws of Sperms Embryo Vial Ids: R175,R176 AND R177 received at 2 cell stage
acrc:21000164 EmtbGFP,K14CreER,Casp8fl K14-EmtbGFP, K14 CreER+ (C57B6) ?, Caspase-8 fl/fl Public Live, Cryo-S Mus Musculus Jamora Lab CJ
acrc:22000050 Emx CreKJ/KJ; Ai9/+ Emx1tm1(cre)Krj/Ncbs; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs Public Live, Cryo-S Mus Musculus Compound Shubha Tole (TIFRmumbai), JAX Ai9 allele originally from JAX#007909, MGI:2684610 - Emx1CreKJ allele also available as JAX#005628, MIXED Homozygote x Homozygote JAX Shubha Tole (TIFRmumbai), JAX
acrc:21000320 Emx1 CreYL/+, TCA/+, Lhx2cKO/cKO Emx1tm1(cre)Yql; TCA-GFP (5-HTT -GFP); Lhx2tm1Monu Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) PMID:10772936 ; MGI:2176219, PMID: 24685175 ; MGI:3772179 Thursday, January 26, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, Emx1CreYL from Yuqing Li, Department of Neurology, University of Florida, TCA-GFP from Takuji Iwasato, Division of Neurogenetics, National Institute of Genetics, Mishima 411-8540, Japan Emx1CreYL = Cre recombinase inserted directly into the exon 1 of the Emx1 gene (PMID:10772936). Emx1creYLF : CCCGATATCATTTACGCGTTAATG ; Emx1creYLR: CACTCATGGAAAATAGCGATC -> 618bp. - TCA-GFP= Reporter mice expressing the membrane-bound enhanced GFP from the sensory thalamus-specific serotonin transporter (5-HTT) promoter PMID: 24685175. primers: TCA-GFP-F: ATGCTGTGCTGTATGAGAAGAACCA ; TCA-GFP-R: TTCTCGTTGGGGTCTTTGCT -> 800 bp.
acrc:21000323 Emx1Cre KJ/KJ; Lhx2sKO/+ Emx1tm1(cre)Krj [Emx1IRES cre]; Lhx2tm1Dra (=Lh2sKO, Lhx -) Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) MGI:2684610 + MGI:1890208 / Emx1CreKJ allele also available as JAX#005628 mixed Lhx2sKO homozygotes are embryonic lethal (E15.5) Thursday, February 9, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX
acrc:21000317 Emx1CreKJ/+, Ldb1cKO/cKO, Ldb2sKO/+ Emx1tm1(cre)Krj ; Ldb1 cKO ; Ldb2 sKO-null Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) PMID:12151506 ; MGI:2684610 + PMID:17664423 - Emx1CreKJ allele also available as JAX#005628 mixed Friday, January 27, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, Susan McConell for Ldb1cKO & Ldb2sKO, JAX Ldb1 G: cttatgtgaccacagccatgcatgcatgtg ; Ldb1-sense: cagcaaacggaggaaacggaagatgtcag -> Ldb1WT: 250bp; Ldb1Mut: 400bp. Ldb2_neo5 5’-CTGTGCTCGACGTTGTCACTG-3’ ; Ldb2_neo3 5’-GATCCCCTCAGAAGAACTCGT-3’; Ldb2_F2 5’-CAGACTGCTCATCACACACTTGTTGAT-3’; Ldb2_R2 5’-CTCAAGAAATCCAAGGGGTGTTACTTA-3’ Ldb2MUT- 400bp and Ldb2WT-700bp.
acrc:21000304 Emx2-Cre Emx2-Cre/+ [RIKEN] Public Live, Cryo-S Mus Musculus RIKEN-CDB CDB0020K B6/N ×（-/+） Thursday, November 22, 2018 1 vial of 2 cell embryos RIKEN-CDB sperm QC efficiency:38.7% Control sperm efficiency for current QC session:98.03%
acrc:21000318 FezF2+/- ; Lhx2cKO/cKO Fezf2tm1Hibi ; Lhx2tm1Monu Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) + RIKEN PMID: 16971467; MGI:3772179 ; PMID: 18202285 mixed Friday, January 27, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, Masahiko Hibi -RIKEN Null allele of Fezf2 [from Masahiko Hibi -RIKEN] gene created by replacing exons containing most of the fezl coding region (amino acids 27-455) with the β-galactosidase and neomycin-resistance genes-
acrc:21000263 FGFR1delta FGFR1delta FRS Public Live, Cryo-S Mus Musculus RIKEN-CDB + From Soriano Lab B6/N B6/N WT X (+/-) Monday, January 29, 2018 1 CryoVial (= 57 2-cell embryos) Phil Soriano
acrc:21000265 Fgfr1n15YF Fgfr1n15YF Public Live, Cryo-E, Cryo-S Mus Musculus CD-1WT X (+/-) Monday, January 29, 2018 1 CryoVial (= 60 2-cell embryos) RIKEN-CDB + Raj Ladher Lab
acrc:21000030 Fibulin5 KO fibulin-5 -/- (C57BL6) Public Cryo-S, Discontinued Mus Musculus Homozygous breeding black Yes The strain Cryopreserved (sperms) and The live colony is discontinued from March 2024 on request of CJ lab rep and confirmation of PI
acrc:21000031 Fibulin5 KO, K14Snail(B6) K14CRE Snail Transgenic, fibulin-5 -/- (C57BL6) Public Live, Cryo-S Mus Musculus Transgenic Jamora Lab K14Snail(B6) X Fibulin5 KO Black Yes CJ
acrc:21000158 Fmr1tm1Cgr fragile X mental retardation syndrome 1 (= Fmr1 KO) Public Live, Cryo-S Mus Musculus Targeted (Null/knockout) David Nelson, Baylor MGI:1857169 backcrossed on B6 since arrived at NCBS outbred every third generation black average litter size of 6-8 pups after the 2nd litter. Almost systematic cannibalism of the first litter and frequent cannibalism of subsequent litters - Around 50% male /female ratio in litters Y ACRC AB, SC
acrc:21000039 FosCreERT2 B6.129(Cg)-Fostm1.1(cre/ERT2)Luo/JNcbs Public Cryo-S Mus Musculus Congenic, Targeted Mutation (Inducible, Recombinase-expressing) JAX -> JNcbs JAX# 21882 C57BL/6J +/+ sibling x Heterozygote OR Heterozygote x C57BL/6J (WT) black 6-9 pups per litter Yes Tuesday, July 14, 2015 2 het males Global JAX/NCBS/Instem transfer agreements_2017 FosCreERT2 strain should NOT be maintained as Homozygotes, since deletion of Fos leads to abnormalities in growth and behavior of the mice as well as growth defects, osteopetrosis, perinatal death [partial penetrance] and abnormalities in tooth eruption, gametogenesis, hemopoiesis, and photoreceptor apoptosis are expected. [old stock ID=acrc:00010]
acrc:21000266 Foxg1-cre [B6NJ] Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6N Public Live, Cryo-S Mus Musculus Targeted (Recombinase-expressing, Null/Knockout) RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337 JAX#004337 received embryos from RIKEN as mixed B6/N ; 129SV RIKEN: ♀B6/N WT×♂Foxg1-cre Mutant homozygous lethal Monday, January 29, 2018 1 CryoVial (= 60 2-cell embryos) -> cryorecovered RIKEN-CDB + 花嶋先生 lab; , JAX from Jax: https://www.jax.org/strain/004337 - "Mice that are homozygous for the targeted mutation die perinatally. The authors also note that in general, the frequency of recombination in Cre;floxed double mutant germline cells appears to be considerably higher than in zygotes produced by breeding Cre mice to floxed mice. This reports that Foxg1-Cre;floxed double mutant males bred to witdtype females produced some offspring with germline deletion of the floxed allele [68.8% (11/16)]. Female germline expression was not determined. As such, for Cre-lox experiments and to avoid/minimize germline deletion of the floxed allele, researchers may consider breeding Foxg1-Cre females to floxed males."
acrc:21000316 Foxg1cKO/+; RCEfrt/frt; Lhx2cKO/cKO; Pax6cKO/cKO Foxg1tm1Fsh ; Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] ; Lhx2tm1Monu ; Pax6tm1Ued (=Pax6LoxP) Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) + JAX Foxg1= PMID: 22726835 ;RCEfrt=[MMRRC Stock No: 32038-JAX (=oldJAX#10812?)]; MGI:3772179 + Pax6cKO=MGI:4354122 mixed Wednesday, January 25, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX, Foxg1: Gordon Fishell, NYU Neuroscience Institute
acrc:21000314 Foxg1cKO/cKO; RCEfrt/frt; Lhx2cKO/cKO Foxg1tm1Fsh ; Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] ; Lhx2tm1Monu Public Cryo-S Mus Musculus cryo for Shubha Tole (TIFR Mumbai) + JAX Foxg1= PMID: 22726835 ;RCEfrt=[MMRRC Stock No: 32038-JAX (=oldJAX#10812?)]; MGI:3772179 mixed Friday, November 25, 2016 Foxg1: Gordon Fishell, NYU Neuroscience Institute, Shubha Tole (TIFRmumbai) for cryo stock, JAX
acrc:21000517 FOXJ1-Cre [H], BetaCat cKO Tg(FOXJ1-cre)Htzm [Holtzman Cre], B6.129-Ctnnb1tm2Kem/Ncbs (beta-Catenin cKO) Public Cryo-S Mus Musculus Transgenic (Recombinase) cryo for Shubha Tole - TIFR Mumbai compund of MGI:2148567 also available as JAX: 004152 and Foxj1 Cre from DOI: 10.1165/rcmb.2006-0475RC- insertion allele not confirmed. Shubha Tole (TIFRmumbai), Michael J Holtzman, JAX This transgene expresses Cre recombinase under the control of 1.2kb of the human FOXJ1 promoter. Cre expression occurs in ciliated epithelial cells present in the pulmonary airways, the choroid plexus, ependyma, oviduct and testis. Their are different variant founder lines of this stock: The line F26 has the highest expression of Cre in the lung compared to the two other founder lines, F14 and F24. (J:136610) Unclear which of these founder line we have here at ACRC.? To cross check with Shubha? PMID: 17255554
acrc:21000246 Foxj1CreERT2::GFP STOCK Foxj1<tm1.1(cre/ERT2/GFP)Htg>/JNcbs Public Live, Cryo-S Mus Musculus Targeted (Inducible, Recombinase-expressing, Reporter) JAX JAX#27012 MIXED (B6J; CD1; 129P2/OlaHsd; 129S4/SvJaeSor) Heterozygote x colony Wild-type OR colonyWild-type x Heterozygote; Homozygotes have a postnatal lethal phenotype. Albino, Black Homozygotes have a postnatal lethal phenotype. YES Wednesday, February 21, 2018 2 (HET X WT) breeding pairs Global JAX/NCBS/Instem transfer agreements_2017, AG AG
acrc:22000028 Foxj1CreERT2::GFP; tdTAi9 STOCK Foxj1<tm1.1(cre/ERT2/GFP)Htg>/JNcbs ; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)] Public Cryo-S Mus Musculus compound JAX-> cryo for Shubha Tole - TIFR Mumbai compound of JAX#27012 & JAX#007909 mixed Foxj1CreERT2::GFP Homozygotes have a postnatal lethal phenotype to Breed as HETs JAX, TIFRmumbai - Shuba Tole
acrc:21000092 Foxp3YFP-cre B6.129(Cg)-Foxp3tm4(YFP/icre)Ayr/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Targeted Mutation JAX JAX# 016959 B6 Homozygote x Hemizygote N Global JAX/NCBS/Instem transfer agreements_2017 AS
acrc:21000008 Foxp3YFP-cre, RaploxP Foxp3YFP-cre, Raptor loxP Public Live, Cryo-S Mus Musculus Targeted KO JAX - AS Components of JAX#016959 and JAX# 013188 B6 Foxp3YFP-cre/WT, Raptor lox/WT (F) X Foxp3YFP-cre +ve, Raptor lox/WT (M) black Y AS
acrc:21000068 FVB/N FVB/NJNcbs Public Cryo-S Mus Musculus WT JAX JAX# 001800 inbred (sibling X sibling) white albino exceptional breeder = old stock imported in 2013 or prior - Filiation unknown Global JAX/NCBS/Instem transfer agreements_2017 = old stock imported in 2013 or prior - Filiation unknown
acrc:21000255 FVB/N_2018 FVB/NJNcbs Public Cryo-E, Cryo-S Mus Musculus WT JAX JAX# 1800 inbred (sibling X sibling) albino white FVB/NJ mice are homozygous for the retinal degeneration 1 allele of Pde6brd1, resulting in blindness by wean age. NO Wednesday, February 21, 2018 3 breeding pairs Global JAX/NCBS/Instem transfer agreements_2017 FVB/NJ mice are homozygous for the retinal degeneration 1 allele of Pde6brd1, resulting in blindness by wean age.
acrc:21000518 Gbx2CreER-IRES-GFP STOCK Gbx2tm1.1(cre/ERT2)Jyhl/JNcbs Public Cryo-S Mus Musculus Targeted Mutation JAX-> TIFRMumbai-> ACRC JAX#022135 JAX, Shubha Tole - TIFR Mumbai
acrc:21000065 GCaMP 4.3 C57BL/6J-Tg(Thy1-GCaMP6s)GP4.3Dkim/JNcbs Public Cryo-S Mus Musculus Transgenic (Reporter) JAX JAX# 024275 Hemizygote x Noncarrier black 5-10 pups per litter N 3 trios Global JAX/NCBS/Instem transfer agreements_2017 USB
acrc:21000248 GCaMP 5.17_2018 C57BL/6JTg(Thy1GCaMP6f)GP5.17Dkim/J Public Live, Cryo-S Mus Musculus Transgenic (Inserted expressed sequence) JAX JAX# 25393 Hemizygote x Noncarrier OR Noncarrier x Hemizygote Black Wednesday, February 21, 2018 2 (Noncarrier X Hemi) breeding pairs Global JAX/NCBS/Instem transfer agreements_2017 USB
acrc:21000033 gdTCR KO gdTCR^-/- Public Live, Cryo-S Mus Musculus isogenic Havran (TSRI) Homozygote x Homozygote Black/Black no Havran (TSRI) CJ
acrc:21000319 GFAPcreER; TCA; Lhx2cKO Tg(GFAP-cre/ERT2)505Fmv ; TCA-GFP (5-HTT-GFP) ; Lhx2tm1Monu Public Live, Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) JAX#012849; PMID: 24685175; MGI:3772179 JAX, TCA-GFP from Takuji Iwasato, Division of Neurogenetics, National Institute of Genetics, Mishima 411-8540, Japan, Shubha Tole (TIFRmumbai) for cryo stocks TCA-GFP= Reporter mice expressing the membrane-bound enhanced GFP from the sensory thalamus-specific serotonin transporter (5-HTT) promoter PMID: 24685175. primers: TCA-GFP-F: ATGCTGTGCTGTATGAGAAGAACCA ; TCA-GFP-R: TTCTCGTTGGGGTCTTTGCT -> 800 bp.
acrc:21000012 gp91phox- B6.129S-Cybbtm1Din/JNcbs (gp91phox-) Public Live, Cryo-S Mus Musculus Congenic, Targeted Mutation JAX JAX# 002365 B6 heterozygote breeding or Het(f) X (hemizygote male) black mutation is X-linked Y JAX AS
acrc:21000247 Grik4cre_2018 C57BL/6Tg(Grik4cre)G324Stl/J Public Live, Cryo-S Mus Musculus Transgenic (Recombinase-expressing) JAX JAX# 6474 Hemizygote x Noncarrier OR Noncarrier x Hemizygote black YES Wednesday, February 21, 2018 2 (Noncarrier X Hemi) breeding pairs Global JAX/NCBS/Instem transfer agreements_2017 USB
acrc:21000428 H2-M10.2 B6;129P2-H2-M10.2tm2Mom/MomJ Public Cryo-S Mus Musculus Targeted (Reporter, Null/Knockout) JAX -> ACRC JAX#007878 Thursday, August 27, 2020 2 sperm straws JAX to TIFRHyd, Adish Dani (TIFR Hyd) Cryo Sperm imported from JAX for Adish Dani on 27 August 2020.
acrc:21000013 H2BeGFP B6.Cg-Tg(HIST1H2BB/EGFP)1Pa/J Public Live, Cryo-S Mus Musculus Congenic, Transgenic JAX JAX# 006069 B6 Hemizygous x Hemizygous black Y Global JAX/NCBS/Instem transfer agreements_2017 AS
acrc:21000041 Htr2a B6;129SB6F1-Htr2a^tm1MMP/ncbs Public Live, Cryo-E, Cryo-S Mus Musculus Targeted Knockout (Exon1 + part of intron2 deletion) MMP B6; 129 Homozygous & Heterozygous Breeding Agouti/ Black 6-9 pups per litter KOF_GTG GAG AGG CTA TTC GGC TAT GA; KOR_TGC CTC GTC CTG CAG TTC ATT C; WTF_GGT ACC GGT GGC CTT TGC C; WTR_tac gga tat ggt cca cac cgc aat NCBS ACRC MMP_______________ original donor ESstrain: G4 ES cells- First Exon + part of Secon intron were deleted. KO PCR band- 200bp; WT PCR band- 201bp
acrc:21000416 Hyh +/- Hyh +/- [#454 written on casette] Public Cryo-S Mus Musculus Cryo Sperm Imported for Adish Dani (TIFR Hyd) Wednesday, July 10, 2019 3 sperm straws Adish Dani - TIFR Hyderabad Cryo Sperm Imported for Adish Dani (TIFR Hyd)
acrc:21000442 IFN-γR C57BL/6N-Ifngr1tm1.1Rds/JNcbs ; interferon gamma receptor 1 Public Live, Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), No functional change) JAX JAX#025394 B6N Homozygote x Homozygote black Friday, November 27, 2020 2 males JAX Jax notes: "These floxed mutant mice possess loxP sites flanking exon 3 and 4 of the Ifngr1 gene. This strain may be useful for generating conditional mutations in applications related to innate immunity. Mouse mutants involving this gene have been used in studies of Zika virus pathogenesis."
acrc:21000444 Ifnar1-fl B6(Cg)-Ifnar1tm1.1Ees/JNcbs / interferon (alpha and beta) receptor 1 Public Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), No functional change) JAX JAX#028256 B6 YES Friday, November 27, 2020 2 males JAX from Jax: "The Ifnar1fl allele has loxP sites flanking exon 3 of the type-I interferon-α/β receptor gene. The Ifnar1 gene encodes the type-I-IFN-receptor which, upon binding type-I interferons, activates JAK-STAT signaling pathways critical for regulating growth, survival, differentiation, pathogen resistance and anti-viral immune responses. Mice homozygous for the floxed allele are viable and fertile with no reported abnormalities."
acrc:21000302 Ift88-fl B6.129P2-Ift88tm1Bky/JNcbs Public Live, Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), No functional change) JAX ->NCBS JAX# 022409 homozygotes can be bred together black Thursday, September 20, 2018 1 breeding pair (Homozygoytes) Global JAX/NCBS/Instem transfer agreements_2017 Sperm QC efficiency-75.8%
acrc:21000016 Il1r1 -/- IL-1R^-/- (B6.129S7-Il1r1tm1Imx/J) interleukin 1 receptor, type I Public Cryo-S Mus Musculus targeted JAX JAX# 003245 Homozygote x Homozygote black 8-10 pups per litter yes Global JAX/NCBS/Instem transfer agreements_2017 CJ
acrc:21000059 ILKflox B6N;129-Ilktm1Star (integrin linked kinase) Public Live, Cryo-S Mus Musculus Gift by Renec St. Arnaud MGI:2668459 ; also available as JAX#23310 Homozygote x Homozygote agouti 4-8 pups per litter No Renec St. Arnaud, JAX SR
acrc:21000384 Jag1-flox B6;129S-Jag1tm2Grid/JNcbs Public Live, Cryo-S Mus Musculus Targeted Mutation JAX -> ACRC JAX#010618 mixed Wednesday, November 27, 2019 JAX These floxed mutant mice possess loxP sites flanking exon 4, which encodes the DSL (Delta-Serrate-Lag2) domain, of the Jag1 gene. This strain may be useful for generating conditional mutations for studies of Notch signaling during development.
acrc:21000330 K14-K8 WTGFP FVB- Tg (K14-K8 WTGFP) Public Cryo-S Mus Musculus transgenic Cryo for Dr Manoj B Mahimkar - ACTREC FVB/N Friday, August 31, 2018 Dr Manoj B Mahimkar - ACTREC Sperm was very weak at collection time - first Cryo IVF efficiency QC is low- would need to repeat the Cryo for this stock-
acrc:21000329 K14-K8S431A-GFP FVB- Tg(K14-K8S431A- GFP) Public Cryo-S Mus Musculus transgenic Cryo for Dr Manoj B Mahimkar - ACTREC FVB/N Friday, August 31, 2018 Dr Manoj B Mahimkar - ACTREC
acrc:21000328 K14-K8S73AGFP FVB- Tg(K14-K8S73AGFP) Public Cryo-S Mus Musculus transgenic Cryo for Dr Manoj B Mahimkar - ACTREC FVB/N Friday, August 31, 2018 Dr Manoj B Mahimkar - ACTREC
acrc:21000058 K14Cre (CD1) Tg(KRT14-cre)1Efu/Ncbs [CD1] Public Cryo-S Mus Musculus Elaine Fuchs (Rockefeller University) albino 10 to 14 pups per litter Yes Elaine Fuchs (Rockefeller University), Srikala Raghavan for Cryo Stocks SR
acrc:21000020 K14Snail (CD1) K14 Snail Tg (CD1 background) Public Live, Cryo-S Mus Musculus Elaine Fuchs (Rockefeller University) albinos Yes Elaine Fuchs (Rockefeller University), Colin Jamora for Cryo CJ; mice died during shipment; repeated import
acrc:21000233 K14Snail (CD1), PAI-1 KO K14Snail (CD1), PAI-1 KO Public Cryo-S, Discontinued Mus Musculus Elaine Fuchs (Rockefeller University) and JAX components of JAX#002507 Strain is cryopreserved(Sperms) and the live colony is discontinued from March 2024 on request of CJ lab rep and confirmation of PI
acrc:21000019 K14Snail(B6) K14 Snail Tg (C57Bl6 background) Public Live, Cryo-S Mus Musculus congenic Elaine Fuchs (Rockefeller University) inbred (sibling X sibling) black 6-8 pups per litter Yes CJ
acrc:21000510 K18-hACE2 [3053] B6N;DBA2-Tg(K18-hACE2)3053Mgef/Blisc [MEDIUM] Public Live, Cryo-S Mus Musculus Transgenic MGEF / Blisc Dec 2022 - N8 backcross on B6/NJNcbs-2020 Hemi X WT MGEF / BLiSC MEDIUM Transgene copy number Line from founder#3053. -- Transgenic- Random insertion of the K18-hACE2 transgene. Mouse model developed at MGEF/ BLiSC facility- The original plasmid used for microinjection is the K18-hACE2 transgene plasmid [PMID: 17079315] kindly donated by Paul B. McCray <paul-mccray@uiowa.edu>. 6 different tg:K18-hACE2 founder Lines were generated at MGEF and are being characterised / analysed and stock amplified- Ready for pre-order. please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:24000001 k18-hACE2 [3068] k18-hACE2 [3068] Public Cryo-S Mus Musculus k18-hACE2 [3068] MGEF_NCBS B6ND2
acrc:21000509 K18-hACE2 [3068] B6N;DBA2-Tg(K18-hACE2)3068Mgef/Blisc [HIGH] Public Live, Cryo-S Mus Musculus Transgenic MGEF / Blisc Dec 2022 - N8 backcross on B6/NJNcbs-2020 Hemi X WT Genotyping PROTOCOL: https://drive.google.com/file/d/1OMdvdITB4cJ03aGoZJGOJICR2jieEONd/view?usp=share_link MGEF / BLiSC HIGH Transgene copy number Line from founder#3068. -- Transgenic- Random insertion of the K18-hACE2 transgene. Mouse model developed at MGEF/ BLiSC facility- The original plasmid used for microinjection is the K18-hACE2 transgene plasmid [PMID: 17079315] kindly donated by Paul B. McCray <paul-mccray@uiowa.edu>. 6 different tg:K18-hACE2 founder Lines were generated at MGEF and are characterised / analysed and stock amplified- Ready for pre-order. please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000511 K18-hACE2 [3102] B6N-Tg(K18-hACE2)3102Mgef/Blisc [LOW] Public Cryo-S Mus Musculus Transgenic MGEF / Blisc july 2021 - N4 backcross on B6/NJNcbs-2020 Hemi X WT MGEF / BLiSC LOW Transgene copy number Line from founder#3102. -- Transgenic- Random insertion of the K18-hACE2 transgene. Mouse model developed at MGEF/ BLiSC facility- The original plasmid used for microinjection is the K18-hACE2 transgene plasmid [PMID: 17079315] kindly donated by Paul B. McCray <paul-mccray@uiowa.edu>. 6 different tg:K18-hACE2 founder Lines were generated at MGEF and are being characterised / analysed and stock amplified- Ready for pre-order. please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000291 KPCBA KrasG12D; Trp53R270H; Pdx1-Cre ; Brca2-Tr1491; Brca2-F11; Aldh2tm1a/tm1a Public Live, Cryo-S Mus Musculus compound MRC? Mixed (C57/BL6J; FVB/N; 129Sv) Friday, June 1, 2018 4 breeding pairs Ashok V, MRC compound breeding of 6 different alleles: 1) Lox-STOP-Lox-KrasG12D. 2) Lox-STOP-Lox-Trp53R270H. 3) Pdx1-Cre. 4) BrCa2-Tr1491. 5) BrCa2-F11. 6) Aldh2tm1a/tm1a. - Brca2-Tr allele is embryonic lethal in the homozygous state (not when heterozygous); Only particular combinations of alleles will lead to the appearance of pancreatic tumours, which eventually result in death of the animals.
acrc:21000407 Lgr5-EGFP, tdT, Casp1-/- B6.129P2-Lgr5tm1(cre/ERT2)Cle , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (tdT) /JNcbs , Caspase-1 -/- Public Live, Cryo-S Mus Musculus compound JAX -> ACRC and Jamora Lab UCSD compound of JAX#008875, JAX# 007914 and Caspase-1 -/- mixed JAX, Colin Jamora
acrc:21000373 Lgr5-EGFP-IRES-creERT2 B6.129P2-Lgr5tm1(cre/ERT2)Cle/JNcbs Public Live, Cryo-S Mus Musculus Targeted (Recombinase-expressing, Reporter, Inducible) JAX JAX#008875 +/+ sibling x Heterozygote homozygous lethal Friday, September 13, 2019 2 breeding pairs JAX
acrc:21000308 Lhx2 cKO/ SKO Lhx2tm1Monu / Lhx2tm1Dra (=Lh2sKO, Lhx -) Public Cryo-S Mus Musculus compound Cryo for Shubha Tole (TIFR Mumbai) MGI:3772179 PMID: 18202285 / MGI:4354122 PMID: 9247336 swiss? - Original Cryo males carried white coat color Lhx2sKO homozygotes are embryonic lethal (E15.5) Wednesday, September 7, 2016 Shubha Tole (TIFRmumbai) SLhx2F: ACCAGACTCAGGGGAAACTCAG; NeoR: ATGCCTGCTTGCCGAATATC; SLhx2R: GTGACTGAACTCCGAACCATTG SLhx2WT: 397 bp; Neo: 600 bp Lhx2cKOF: ACCGGTGGAGGAAGACTTTT; Lhx2cKOR: CAGCGGTTAAGTATTGGGACA Lhx2cKOWT: 144 bp; Conditional: 188 bp
acrc:21000307 Lhx2 cKO; ROSAmTmG/mTmG Lhx2tm1Monu ; Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo Public Cryo-S Mus Musculus compound Cryo for Shubha Tole (TIFR Mumbai) compound MGI:3772179 ; PMID: 18202285 + JAX# 007676 mixed - original Cryo males were agouti Friday, September 2, 2016 Shubha Tole (TIFRmumbai) + JAX Genotyping Primers: Lhx2cKOF: ACCGGTGGAGGAAGACTTTT; Lhx2cKOR: CAGCGGTTAAGTATTGGGACA Lhx2WT: 144 bp; Conditional: 188 bp
acrc:21000309 Lhx2cKO/cKO; Pax6cKO/cKO Lhx2tm1Monu ; Pax6tm1Ued (=Pax6LoxP) Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFRmumbai) MGI:3772179 ; PMID: 18202285 + MGI:4354122; PMID: 19500363 Mixed- Original Cryo Males carried white coat Friday, September 2, 2016 Shubha Tole (TIFRmumbai) for Cryo Stocks Pax6 cKOF: AAATGGGGGTGAAGTGTGAG; Pax6cKOR: TGCATGTTGCCTGAAAGAAG Pax6: 156 bp; Pax6Conditional: 195 bp Lhx2cKOF: ACCGGTGGAGGAAGACTTTT; Lhx2cKOR: CAGCGGTTAAGTATTGGGACA Lhx2cKOWT: 144 bp; Lhx2cKOConditional: 188 bp
acrc:21000468 Lmx1aCre Tg(Lmx1a-EGFP/cre)Kjmi/Ncbs Public Cryo-S Mus Musculus MGI:4461311 Shubha Tole (TIFRmumbai) for Cryo Stocks Initially rederived and recryoed from S17_ST_Lmx1aCre/+;Bmp2cko/+;Bmp4cko/+_103. (for IIT-Kanpur- Amitabha)
acrc:21000326 Lmx1aCre/+; Bmp2cko/+; Bmp4cko/+ Tg(Lmx1a-EGFP/cre)Kjmi ; Bmp2cko; Bmp4cko Public Cryo-S Mus Musculus cryo for Shubha Tole (TIFR Mumbai) MGI:4461311 + PMID: 17194222(For both Bmp2 and 4) Lethality for homoz at Bmp2 and 4 loci. Hets survive till adulthood. Tuesday, June 13, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, Bmp2 and Bmp4 double conditional mice were originally generated by Prof. Amitabha Bandyopadhyay's lab, @ IITK, Lmx1aCre is from Prof. Kathy Millen Bmp2 Forward primer: 5’ GTGTGGTCCACCGCATCAC; Bmp2 Reverse primer: 5’ GGCAGACATTGTATCTCTAGG; -> Bmp2mut: 450bp ; Bmp2WT: 370bp - Bmp4 Forward primer: 5’ AGACTCTTTAGTGAGCATTTTCAAC; Bmp4 Reverse primer: 5’ AGCCCAATTTCCACAACTTC. -> Bmp4mut: 240bp; Bmp4WT: 160bp-
acrc:21000089 LSL-Cas9 (Rosa26) B6;129-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J (Rosa26-floxed STOP-Cas9 knockin) Public Cryo-S Mus Musculus Targeted - KI JAX JAX# 024857 B6; 129 Heterozygote x Heterozygote OR Homozygote x Homozygote OR Homozygote x Inbred and recip black Y Thursday, January 14, 2016 2 breeding pairs (litter mate homozygotes: DOB- 22 Dec 2015) Global JAX/NCBS/Instem transfer agreements_2017 MGEF
acrc:21000524 MADM-12-GT; GFAPcreER MADM-12-GT; Tg(GFAP-cre/ERT2)505Fmv Public Cryo-S Mus Musculus compound cryo for Shubha Tole - TIFR Mumbai Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? + JAX#012849 JAX, MADM alleles from Simon Hippenmeyer (IST Austria), Shubha Tole (TIFR Mumbai) MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000523 MADM-12-TG; Foxg1cKO MADM-12-TG; Foxg1tm1Fsh Public Cryo-S Mus Musculus compound cryo for Shubha Tole - TIFR Mumbai Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? + J:188355 Foxg1: Gordon Fishell, NYU Neuroscience Institute (PMID: 22726835) , , MADM alleles from Simon Hippenmeyer (IST Austria) , , Shubha Tole (TIFR Mumbai) MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000520 MADM-2-GT MADM-2-GT Public Cryo-S Mus Musculus cryo for Shubha Tole - TIFR Mumbai Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria) MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000519 MADM-2-TG; Lhx2 cKO MADM-2-TG; Lhx2tm1Monu Public Cryo-S Mus Musculus cryo for Shubha Tole - TIFR Mumbai compound of Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? & MGI:3772179 Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria) MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000522 MADM-9-GT MADM-9-GT Public Live, Cryo-S Mus Musculus cryo for Shubha Tole - TIFR Mumbai Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria) MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000521 MADM-9-TG MADM-9-TG Public Cryo-S Mus Musculus cryo for Shubha Tole - TIFR Mumbai Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria) MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000548 Malat1 KO Malat1tm1.2Dlsp Public Live, Cryo-S Mus Musculus targeted KO MGI:5496055 original: (C57BL/6 x 129S4/SvJae)F1 Wednesday, November 3, 2021 2 males and 2 females for rescue breeding and cryo IISc- Rescue Breeding Request for Prof. K.N. Balaji / IISc, original Stock from: Prof David L. Spector- CSHL [Cold Spring Garbor Lab- USA]
acrc:21000055 Mesp1Cre Mesp1tm2(cre)Ysa/Ncbs Public Live, Cryo-S Mus Musculus KI Pasteur Institute Paris MGI:2176467 Y Pasteur Institute Paris RS
acrc:21000022 MindinKO(B6) Mindin KO (C57Bl6) Public Live, Cryo-S Mus Musculus He Lab (Duke University) KO X KO Black 6-8 pups per litter No He Lab (Duke University), Colin Jamora CJ
acrc:23000031 Mns1(dex3/+)#14 Mns1(dex3/+)#14[RIKEN] Public Cryo-S Mus Musculus RIKEN [CDB0299E] Monday, April 3, 2023 Imported 2 straws of Sperms
acrc:21000137 Myf5Cre B6;129-Myf5tm1(cre)Mrc/JNcbs Public Cryo-S Mus Musculus Targeted Mutation JAX JAX# 010529 Homozygote x Homozygote OR Heterozygote breeding 5 hets JAX, Ramkumar Sambasivan Sperm Donor Genotype not yet confirmed.
acrc:21000052 Myf5nlacz Myf5tm1Pas/Ncbs Public Live, Cryo-S Mus Musculus Targeted (Null/knockout, Reporter) - KI Tajbakhsh Lab (Pasteur Institute Paris) MGI:1857973 or JAX# 018626 mixed (f)B6D2F1 X (m)Myf5nlacZ/+ heterozygote breeding Black 8-12 pups per litter Y JAX, Ramkumar Sambasivan RS
acrc:21000036 MYH7hum C57BL/6NTac-Myh6^tm3169(MYH7)Arte/Ncbs Public Live, Cryo-E, Cryo-S Mus Musculus Knock-in (whole-gene replacement - humanized) John Mercer - made at TaconicArtemis intercrossed since 2013? hum/+ x +/+ or hum/+ intercross (either direction) black Y Saturday, November 14, 2015 Instem - ACRC JAM
acrc:22000007 NesCre Tg(Nes-cre)1Kln/CjDswJNcbs [Nestin Cre] Public Live, Cryo-S Mus Musculus Rederived from Shubha Tole NesCre/+, Lhx2SKO/+ Cryo Stocks JAX#019103 JAX, BLiSC Rederived from S17_ST_NesCre/+;Lhx2sko/+_102. on B6N background and then maintained by Bhavana's Lab. Lhx2 allele was outcrossed.
acrc:21000325 NesCre/+, Lhx2SKO/+ B6N.Cg-Tg(Nes-cre)1Kln/CjDsw/+ [Nestin Cre], Lhx2tm1Dra (=Lh2sKO, Lhx -) Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) JAX#019103 + MGI:1890208 Lhx2sKO homozygotes are embryonic lethal (E15.5) Nes-cre Transgene is mapped to Chr12- JAX Genotype protocol same as for JAX stock #003771 Monday, June 13, 2016 Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX (Nesting Cre allele) The Nestin Cre allele was initially wrongly referenced as the Amelia Eisch Nestin CreERT2 allele- But Shubha corrected this: THIS IS NOT the NestinCreERT2 allele from Amelia Eisch. It's a constitutive Nes-Cre promoter (originally from JAX#019103). Nes-Cre Transgene is mapped to Chr12- JAX genotyping proctocol same as for JAX Genotype protocol same as for JAX stock #003771 = able to distiguish hemi from homo: https://www.jax.org/Protocol?stockNumber=003771&protocolID=31758
acrc:22000051 NesCre/NesCre; Ai9/Ai9 Tg(Nes-cre)1Kln/CjDswJNcbs [Nestin Cre]; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)] Public Live, Cryo-S Mus Musculus Compound Shubha Tole (TIFRmumbai), JAX Ai9 allele originally from JAX#007909; Nes cre- JAX#019103 Mixed Homozygote x Homozygote JAX
acrc:21000349 Nestin-cre/ERT2 AE C57BL/6-Tg(Nestin-cre/ERT2)KEisc/Ncbs Public Live, Cryo-S Mus Musculus Transgenic (Recombinase-expressing, Inducible) imported to ACRC from Vidita Vaidya (TIFR Mumbai) - Original Stock from Amelia Eisch - UPenn MGI:3767432 - also available as JAX stock#016261 Amelia Eisch - eisch@upenn.edu ; Amelia.Eisch@utsouthwestern.edu, JAX
acrc:21000348 Nestin-GFP Tg(Nestin-rtTA*M2,-EGFP)Sker (PN18 or PN9 insertion?) Public Live, Cryo-S Mus Musculus Transgenic (Reporter, Transactivator) imported to ACRC from Vidita Vaidya (TIFR Mumbai) - Original Stock from Steven G Kernie- Columbia University MGI:6193952 OR MGI:6193950 alleles to be confirmed Steven G Kernie - Columbia University
acrc:21000315 NestinCreERT2/+, Lhx2cKO/cKO; Pax6 cKO/+ Nestin Cre ERT2? [TBD] ; Lhx2tm1Monu; Pax6tm1Ued (=Pax6LoxP) Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) nestingCre? + MGI:3772179 + MGI:4354122 mixed Wednesday, January 25, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, NestinCre under an MTA with ShubhaTole TIFR Mumbai & Amelia Eisch (Amelia.Eisch@utsouthwestern.edu) Jan2019- After Having rederived this stock for HSG - zero Cre positive animals were found + there seems to be a confusion on the original Nestin Cre allele of this stock- This needs to be clarified with Shubha again.
acrc:21000170 NestinRHCreER, Stim f/f NestinRHCreER, Stim f/f Public Live, Cryo-E, Cryo-S Mus Musculus GH
acrc:21000382 Neurog1-CreERT2 B6;129P-Tg(Neurog1-cre/ERT2)1Good/JNcbs Public Live, Cryo-S Mus Musculus transgenic Cre JAX -> ACRC JAX#008529 mixed B6J & 129P Wednesday, November 27, 2019 JAX Sperm QC efficiency:23.07% Control efficiency for QC Session:98.03%
acrc:21000321 Nex Cre/Cre, TCA/+, Lhx2cKO/cKO Neurod6tm1(cre)Kan [Nex Cre] ; TCA-GFP (5-HTT -GFP) ; Lhx2tm1Monu Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) MGI:2668659 + PMID: 24685175 + MGI:3772179 mixed Thursday, January 26, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks, TCA-GFP from Takuji Iwasato, Division of Neurogenetics, National Institute of Genetics, Mishima 411-8540, Japan NexF: GAGTCCTGGAATCAGTCTTTTTC; NexR: AGAATGTGGAGTAGGGTGAC; NexCre-MutR: CCGCATAACCAGTGAAACAG. ->NexWT =770 bp ; Nexcre= 525 bp. TCA-GFP= Reporter mice expressing the membrane-bound enhanced GFP from the sensory thalamus-specific serotonin transporter (5-HTT) promoter PMID: 24685175. primers: TCA-GFP-F: ATGCTGTGCTGTATGAGAAGAACCA ; TCA-GFP-R: TTCTCGTTGGGGTCTTTGCT -> 800 bp.
acrc:21000028 NF1 fl/fl, K14Cre(B6) NF1 fl/fl, K14Cre(B6) Public Live, Cryo-S Mus Musculus congenic Jamora Lab NF1flox allele also available as JAX#017639 heterozygote X homozygote Black Yes JAX, Colin Jamora Stock Cryoarchived for CJ lab. - The Nf1flox mice possess loxP sites flanking exons 31-32 of the neurofibromatosis 1 gene (Nf1), and have applications in studying cancer, neural crest development and neurofibromatosis type I.
acrc:21000324 Nfia+/- Nfiatm1Rmg Public Cryo-S Mus Musculus cryo for Shubha Tole (TIFR Mumbai) PMID: 20610746 Embryos homozygous for Nfia null allele are lethal- Friday, June 30, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks Nfia Fwd: CGTGAGCTGGTACAGTTTGCA ; Nfia R: TGTTTGAGAATCTTTCTTCCTTTGG; Nfia-neoR: GCCTGAAGAACGAGATCAGCA. -> NfiaMutant ~350bp ; NfiaWT ~500 bp.
acrc:21000322 Nfia+/-; Lhx2cKO/cKO Nfiatm1Rmg ; Lhx2tm1Monu Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) PMID: 20610746 + MGI:3772179 mixed Embryos homozygous for Nfia null allele are lethal Tuesday, February 7, 2017 Shubha Tole (TIFRmumbai) for Cryo Stocks Nfia Fwd: CGTGAGCTGGTACAGTTTGCA ; Nfia R: TGTTTGAGAATCTTTCTTCCTTTGG; Nfia-neoR: GCCTGAAGAACGAGATCAGCA. -> NfiaMutant ~350bp ; NfiaWT ~500 bp.
acrc:21000072 NODscid NOD.CB17Prkdc<scid>/JNcbs Public Cryo-S, Discontinued Mus Musculus Spontaneous mutation JAX JAX# 001303 Homozygote x Homozygote white albino good breeder = old stock imported in 2013 or prior - Filiation unknown Global JAX/NCBS/Instem transfer agreements_2017 AF - Very old stock - now leaky- = old stock imported in 2013 or prior - Filiation unknown- we strongly recommend you use the NSG (JAX#005557) stocks instead-
acrc:21000412 Notch-4-loxP Notch4lox/lox Public Live, Cryo-S Mus Musculus Targeted Lox/Lox Apurva Sarin B6 ACRC- AS
acrc:21000111 NPHS2cre B6.Cg-Tg(NPHS2-cre)295Lbh/JNcbs ( => 2.5P-Cre) Public Live, Cryo-S Mus Musculus Congenic, Transgenic (Recombinase-expressing) JAX JAX# 008205 Noncarrier x Hemizygote black Y Friday, October 10, 2014 5 females + 4 males JAX Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000235 NSG_2017 NOD.Cg-Prkdc<scid> Il2rg<tm1Wjl>/SzJNcbs Public Live, Cryo-E, Cryo-S Mus Musculus immunocompromised / double mutant JAX JAX#005557 Females are Homozygotes for Prkdc<scid> and Il2rg<tm1Wjl>- Males are Homozygotes for Prkdc<scid> and hemizygotes for Il2rg<tm1Wjl> Wednesday, September 13, 2017 2 breeding pairs NSG mice require Lab PI specific JAX MTAs, _active NSG MTAs for: CJ + JD + MI + SR + SRD + HSG + SK _
acrc:21000439 NSG_2020 NOD.Cg-Prkdc<scid> Il2rg<tm1Wjl>/SzJNcbs Public Live, Cryo-E, Cryo-S Mus Musculus immunocompromised / double mutant JAX JAX#005557 NOD albino Females are Homozygotes for Prkdc<scid> and Il2rg<tm1Wjl>- Males are Homozygotes for Prkdc<scid> and hemizygotes for Il2rg<tm1Wjl> Friday, November 27, 2020 5 breeding pairs JAX NSG mice require Lab PI specific JAX MTAs, _active NSG MTAs for: CJ + JD + MI + SR + SRD + HSG + SK
acrc:21000438 NUde_2020 NU/JNcbs ; Foxn1^ nude Public Live, Cryo-E, Cryo-S Mus Musculus inbred, spontaneous mutation, immunodeficient JAX JAX#002019 HET X HET or HOMO (males) X HET (females) - Homo females are very poor breeders HET or WT (albino) ; HOMO (hairless) YES Friday, November 27, 2020 4 HET breeding pairs JAX from Jax: "The two main defects of mice homozygous for the nude spontaneous mutation (Foxn1nu, formerly Hfh11nu) are abnormal hair growth and defective development of the thymic epithelium. Nude mice are also athymic; homozygous nude mice lack T cells and suffer from a lack of cell-mediated immunity. Homozygous nude mice show partial defect in B cell development. Homozygous nude females are not effective breeders. Ovulation starts late at 2.5 months and ends early at 4 months. "
acrc:21000161 Oct4GFP Tg(Pou5f1-EGFP)2Mnn/Ncbs (=Oct4-DPE-GFP, OG2, TgOG2) Public Cryo-S Mus Musculus Transgenic (Reporter) Richard Harvey or Dr. Hans R. Schöler (Max Planck)? MGI:3057158 or JAX#004654 Dr. Hans R. Schöler (Max Planck) JD
acrc:21000413 OMP-Cre B6;129P2-Omptm4(cre)Mom/MomJ Public Cryo-S Mus Musculus JAX -> ACRC JAX#006668 Thursday, August 27, 2020 2 sperm straws JAX to TIFRHyd, Adish Dani (TIFR Hyd) Cryo Sperm imported from JAX for Adish Dani on 27 August 2020. - 2straws received - Cryo-recovered / rederived on B6/JNcbs for Adish Dani (September 2020)
acrc:21000419 OMP:Chr2-YFP OMP:Chr2-YFP (AD) #460-1 written on casette Public Cryo-S Mus Musculus Cryo Sperm Imported for Adish Dani (TIFR Hyd) Wednesday, July 10, 2019 3 sperm straws Adish Dani - TIFR Hyderabad Cryo Sperm Imported for Adish Dani (TIFR Hyd)
acrc:21000364 OT-1 C57BL/6-Tg(TcraTcrb)1100Mjb/J Public Live, Cryo-S Mus Musculus Transgenic (Inserted expressed sequence) JAX JAX#003831 C57BL/6J Homozygote X Homozygote or Hemizygote X C57BL/6J black Friday, September 13, 2019 2 breeding pairs JAX TIFRHyd stocks- Like most TCR transgenics, these mice are somewhat immunodeficient.
acrc:21000088 OT-II B6.Cg-Tg(TcraTcrb)425Cbn/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Transgenic (Inserted expressed sequence) JAX JAX# 004194 B6 Homozygote x Homozygote good breeder N AS
acrc:21000365 OT-II_2019 B6.Cg-Tg(TcraTcrb)425Cbn/JNcbs Public Cryo-S Mus Musculus Transgenic (Inserted expressed sequence) JAX JAX#004194 C57BL/6J Homozygote x Homozygote black Friday, September 13, 2019 2 breeding pairs JAX to TIFRHyd TIFRHyd.
acrc:21000113 Padosan lox Padosan lox/lox Public Live, Cryo-S Mus Musculus RIKEN original: C57BL/6 × CBA ? / MIXED Homozygote x Homozygote black eye /agouti coat Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000024 PAI-1 KO B6.129S2-Serpine1tm1Mlg/JNcbs Public Live, Cryo-S Mus Musculus congenic JAX JAX#002507 het X knock-out black 6-8 pups per litter Yes Global JAX/NCBS/Instem transfer agreements_2017 CJ
acrc:21000445 PARP1-KO 129S-Parp1tm1Zqw [ADPRT] Public Live, Cryo-S Mus Musculus ko JAX-> IISc-> NCBS JAX#002779 JAX, IISc - N. Ravi Sundaresan <rsundaresan@iisc.ac.in> mice maintained in V1 for DP lab / IISC Ravi Sundaresan collaborative work.
acrc:21000313 Pax6+/- ; Lhx2cKO/cKO Pax6 small eye ; Lhx2tm1Monu Public Cryo-S Mus Musculus compound, cKO cryo for Shubha Tole (TIFR Mumbai) MGI:1856155 ; PMID: 8951061 + MGI:3772179 ; PMID: 18202285 mixed - original Cryo males were agouti Pax6 small eye -/- mutants are Lethal; Perinatal death. Wednesday, November 23, 2016 Shubha Tole (TIFRmumbai) for Cryo Stocks Pax6 +/- : Phenotypically distinguished by presence of small eye
acrc:21000049 Pax7CreERT2 B6;129-Pax7tm2.1(cre/ERT2)Fan/JNcbs Public Cryo-S Mus Musculus KI - Targeted Mutation JAX Jax# 012476 heterozygote breeding Black 8 to 12 pups per litter Y genotype of sperm donor animals not fully confirmed- Only one lysate(Biopsy ID-1330) out of the three different donor males shown to give positive band for CRE.
acrc:21000050 Pax7GPL Pax7tm1Tajb/Ncbs (= Pax7nGFP-Puro/nlacZ) Public Cryo-S Mus Musculus Targeted KI (Null/knockout, Reporter) Tajbakhsh Lab (Pasteur Institute Paris) MGI:3850147 Black 8 to 12 pups per litter N Tajbakhsh Lab (Pasteur Institute Paris) RS
acrc:21000048 Pax7nGFP Tg(Pax7-EGFP)Tajb/Ncbs Public Cryo-S Mus Musculus Transgenic Tajbakhsh Lab (Pasteur Institute Paris) MGI:5308730 Homozygous breeding Black good litter size (8-12 pups) N RS, JD
acrc:21000034 Pcp2Cre B6.129-Tg(Pcp2-cre)2Mpin/JNcbs Public Live, Cryo-S Mus Musculus Transgenic (Recombinase-expressing) JAX JAX# 004146 B6.129 Homozygote x Homozygote black 6 to 9 litter size. Gender varies with each litter.Canabilization was observed in two cages twice Yes 3 breeding pairs JAX - NCBS relocation agreements
acrc:21000091 Pcp2EGFP B6;FVB-Tg(Pcp2-EGFP)2Yuza/JNcbs Public Cryo-E, Cryo-S Mus Musculus Transgenic (Reporter) JAX JAX# 004690 B6;FVB Hemizygous x Hemizygous black 8-12 pups per litter Y 3 breeding pairs JAX - NCBS relocation agreements
acrc:21000009 PepBoy B6.SJL-Ptprca Pepcb/BoyJNcbs Public Cryo-S Mus Musculus Congenic JAX JAX# 002014 inbred (sibling X sibling) black N JAX - NCBS relocation agreements FO cryopreserved
acrc:21000367 PepBoy_2019 B6.SJL-Ptprca Pepcb/BoyJNcbs Public Live, Cryo-E, Cryo-S Mus Musculus JAX JAX#002014 C57BL/6J sibing X sibling black Friday, September 13, 2019 2 breeding pairs JAX to TIFRHyd, JAX instem/ncbs agreements TIFRHyd- This C57BL/6 congenic strain is used widely in transplant studies because it carries the differential pan leukocyte marker Ptprca, commonly known as CD45.1 or Ly5.1. Wild-type C57BL and BALB/c inbred strains express the Ptprcb (CD45.2 or Ly5.2) allele.- A spontaneous mutation in the Ncr1 gene is segregating in this strain-
acrc:21000051 PGKCre Tg(Pgk1-cre)1Lni/Ncbs Public Live, Cryo-S Mus Musculus Transgenic (Recombinase) Pasteur Institute Paris (Yvan Lallemand) MGI:2178050 ; also available as JAX#020811 (on B6) mixed (strain of origin: (BALB/c x C57BL/6)F2) Homozygous breeding Coco or Black 8-12 pups per litter N Pasteur Institute Paris (Yvan Lallemand), JAX RS
acrc:21000303 PLPcreER B6.Cg-Tg(Plp1-cre/ERT)3Pop/JNcbs Public Live, Cryo-S Mus Musculus Transgenic (Recombinase-expressing, Inducible) JAX ->NCBS JAX# 005975 C57BL/6J Hemizygote x +/+ sibling OR Hemi X Hemi black Thursday, September 20, 2018 1 breeding pair (Hemizygoytes) JAX
acrc:21000366 Prf1 KO C57BL/6-Prf1tm1Sdz/J Public Cryo-S Mus Musculus Targeted (Null/Knockout) JAX JAX#002407 C57BL/6J Homozygote x Homozygote black Friday, September 13, 2019 2 breeding pairs JAX to TIFRHyd TIFRHyd- This colony is maintained by breeding homozygous siblings; reproduction performance is similar to C57LB/6J. Young mutants are susceptible to mouse hepatitis virus, but after reaching about eight weeks of age, they survive well conventional animal housing conditions. The expected coat color from breeding is black.
acrc:21000143 R26R B6.129S4-Gt(ROSA)26Sortm1Sor/JNcbs Public Live, Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), Reporter) JAX#003474 imported by CJ from UCSD? JAX, ACRC These Gt(ROSA)26Sortm1Sor targeted mutant mice carry a loxP flanked neo cassette upstream of a β-galactosidase (lacZ) sequence. Removal of the neo cassette by cre recombination results in lacZ expression in cre-expressing tissues of the offspring. These mutant mice may be used as a Cre-reporter strain to test the tissue/cellular expression pattern of cre expressing mice.
acrc:21000300 R26R-Confetti B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/JNcbs -[R26R-Confetti] Public Live, Cryo-S Mus Musculus Targeted (Conditional ready (e.g. floxed), Reporter) JAX ->NCBS JAX# 017492 C57BL/6J recommended Het X Het - -- Homo X Homo are reported to be viable and fertile black Thursday, September 20, 2018 1 breeding pair (Homozygoytes) JAX
acrc:21000274 R26R-H2B-EGFP R26R-H2B-EGFP [H2BG#42(loxp/loxp)] Public Live, Cryo-E, Cryo-S Mus Musculus targeted reporter [nucleus] RIKEN-CDB CDB0203K B6/N Monday, January 29, 2018 2 cryo-vials RIKEN-CDB R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:24000036 R26R-hACE2 [6557] R26R-hACE2 [6557] Public Cryo-S Mus Musculus MGEF B6ND2
acrc:24000037 R26R-hACE2 [6665] R26R-hACE2 [6665] Public Cryo-S Mus Musculus MGEF B6ND2
acrc:21000567 R26R-mito-DarT [#12] B6N;DBA2-Rosa26^em2(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#12] Public Live, Cryo-S Mus Musculus crispr/Cas9 targeted knockIn MGEF MGEF / BLiSC, Raj Ladher RajLadher Lab. MGEF project: Inj21_RL_Mona_R26-DarT-KI_609
acrc:21000566 R26R-mito-DarT [#1] B6N;DBA2-Rosa26^em1(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#1] Public Live, Cryo-S Mus Musculus crispr/Cas9 targeted knockIn MGEF MGEF / BLiSC, Raj Ladher RajLadher Lab. MGEF project: Inj21_RL_Mona_R26-DarT-KI_609
acrc:21000568 R26R-mito-DarT [#54] B6N;DBA2-Rosa26^em3(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#54] Public Live, Cryo-S Mus Musculus crispr/Cas9 targeted knockIn MGEF MGEF / BLiSC, Raj Ladher RajLadher Lab. MGEF project: Inj21_RL_Mona_R26-DarT-KI_609
acrc:21000277 R26R-Mito-EGFP R26R-Mito-EGFP/MitoG#22(loxP/loxP) Public Cryo-E, Cryo-S Mus Musculus targeted reporter [mitochondria] RIKEN-CDB CDB0216K B6/N RIKEN-CDB June 2018- Cryorecovery failed - two new CryoVials arrived 22 Nov2018- cryorecovered OK
acrc:21000283 R26R-ZO1-EGFP R26R-ZO1-EGFP [#137(loxP/loxP)] [Tight Junctions] Public Live, Cryo-E, Cryo-S Mus Musculus targeted reporter [Tight Junctions] RIKEN-CDB CDB0225K B6/N Monday, January 29, 2018 2 cryo-vials RIKEN-CDB R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000075 Rag1KO B6.129S7-Rag1tm1Mom/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Targeted Mutation JAX Jax# 002216 Homozygote x Homozygote black immuno compromised Y Saturday, November 29, 2014 2 breeding pairs Global JAX/NCBS/Instem transfer agreements_2017 SC
acrc:21000093 RaploxP B6.Cg-Rptortm1.1Dmsa/JNcbs (Rap^loxP) Public Live, Cryo-S Mus Musculus Congenic, Targeted Mutation JAX JAX# 013188 B6 Homozygote x Homozygote N AS
acrc:21000102 RCE Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh/Ncbs [RCE:FRT] Public Live, Cryo-S Mus Musculus Targeted Gordon Fishell (NY) MGI:4420764 ; MMRRC Stock No: 32038-JAX JAX, Gord Fishell, Harvard Medical School HSG
acrc:21000053 ROSA nlacZ Gt(ROSA)26Sor tm1(nls-lacZ)JFN/Ncbs Public Live, Cryo-S Mus Musculus Tg JF Nicolas (Pasteur Institute Paris) Homozygous breeding White 8-12 pups per litter N JF Nicolas (Pasteur Institute Paris) RS
acrc:21000292 Rosa26-DTA176 B6;129-Gt(ROSA)26Sortm1(DTA)Mrc/JNcbs Public Live, Cryo-S Mus Musculus Gene Trap, Targeted (Conditional ready (e.g. floxed), Inserted expressed sequence, No functional change) JAX -> NCBS JAX# 10527 original: (129X1/SvJ x 129S1/Sv)F1-Kitl+ ; mixed B6 Homozygote x Homozygote agouti Thursday, September 20, 2018 2 homozygote males JAX
acrc:21000123 ROSACreERT2 B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/JNcbs Public Cryo-S Mus Musculus Congenic, Targeted Mutation JAX JAX# 008463 Homozygote x Homozygote black Saturday, November 29, 2014 3 breeding pairs JAX - NCBS relocation agreements shared (RS, SR, JD)
acrc:21000312 ROSACreERT2/+, Lhx2cKO/+, BetaCat cKO/cKO Gt(ROSA)26Sortm1(cre/ERT2)Tyj ; Lhx2tm1Monu ; Ctnn1b tm2Kem (beta Catenin) Public Cryo-S Mus Musculus compound cryo for Shubha Tole (TIFR Mumbai) + JAX compound from JAX#008463 + MGI:3772179 + JAX#004152 ;MGI:2148567 mixed - original Cryo males were agouti Friday, November 25, 2016 Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX
acrc:21000473 ROSACreERT2/+, Lhx2cKO/cKO Gt(ROSA)26Sortm1(cre/ERT2)Tyj , Lhx2tm1Monu / Ncbs Public Live, Cryo-S Mus Musculus rederived from Shubha Tole Stocks- TIFR Mumbai compound of JAX#008463 & MGI:3772179 Saturday, March 6, 2021 Shubha Tole (TIFRmumbai), JAX, BM BM imported from TIFR Mumbai
acrc:21000513 ROSACreERT2/+, Lhx2cKO/cKO, Ai9/+ B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/JNcbs, Lhx2tm1Monu/Ncbs, Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/Ncbs Public Live, Cryo-S Mus Musculus compound rederived from Shubha Tole Stocks- TIFR Mumbai compound of JAX# 008463, MGI:3772179, JAX#007909 mixed JAX, Shubha Tole - TIFR Mumbai BM
acrc:21000002 ROSAmT/mG B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/JNcbs Public Cryo-S Mus Musculus congenic JAX JAX# 007676 ; MGI:3716464 Homozygous breeding black 8-12 pups per litter N (homozygote) 3 breeder pairs Global JAX/NCBS/Instem transfer agreements_2017 Genotyping Primers: mTmG F: CTCGCTGCCTCCTGGCTTCT; mTmG R: CGAGGCGGATCACAAGCAATA; mTmG mutant: TCAATGGGCGGGGGTCGTT Mutant: 250 bps; Wild type: 350 bps
acrc:21000073 Rud lox Rudhira lox / Ncbs (= Bcas3 lox ; breast carcinoma amplified sequence 3) Public Live, Cryo-S Mus Musculus RIKEN -> Ncbs original: C57BL/6 × CBA (transgenic) Homozygote X Homozygote black Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000074 Rud-mCherry Rudhira-mCherry (= Bcas3-mCherry) Public Cryo-S Mus Musculus RIKEN -> Ncbs original: C57BL/6 × CBA (transgenic) Hemizygote X Hemizygote black RIKEN- CDB, NCBS- Maneesha Inamdar ( JNCSAR) Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000108 Scgb1a1-CreER B6N.129S6(Cg)-Scgb1a1tm1(cre/ERT)Blh/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Targeted Mutation JAX JAX# 016225 Homozygote x Homozygote Global JAX/NCBS/Instem transfer agreements_2017 AG
acrc:21000327 Scnn1a-Tg3-Cre B6;C3-Tg(Scnn1a-cre)3Aibs Public Cryo-S Mus Musculus cryo for Neeraj Jain (NBRC) JAX#009613 Tuesday, November 20, 2018 Neeraj Jain (NBRC) for Cryo Stock, JAX
acrc:21000218 Sept7 fl/+; Stim1 fl/+; tdT/+ Sept7 flox/+; Stim1 flox/+; Ai14tdT/+ Public Cryo-S Mus Musculus
acrc:21000157 Shiverer C3Fe.SWV-Mbpshi/JNcbs, (C3HeB/FeJ-shiverer) Public Live, Cryo-S Mus Musculus Congenic, Spontaneous Mutation JAX JAX# 001428 Homozygote (M) x Heterozygote (F) black lack of myelin - homozygous animals begin shivering by 2 months of age Y JAX SC
acrc:24000052 Sirt1 delE2/+;Cre+;nnt+/- Sirt1 delE2/+;Cre+;nnt+/- Public Cryo-S Mus Musculus Heterozygous ULLAS_TIFR HYD B6N/J
acrc:24000049 Sirt1 E4 lox/lox: Cre/Cre; nnt +/+ Sirt1lox/lox: Ert2 Cre/Cre; nnt+/+ Public Live, Cryo-S Mus Musculus Homozygous ULLAS_TIFR HYD B6N/J
acrc:21000332 Sirt1 lox B6;129-Sirt1 tm1Ygu Public Live, Cryo-S Mus Musculus Targetted KI Cryo for Ullas Kolthur - TIFRmumbai - JAX JAX#008041 C57BL/6NCrl Thursday, January 12, 2017 Ullas Kolthur for Cryostocks, JAX Note from Ullas: This was continuously backcrossed with C57BL/6NCrl for 9 generations. The Cryo males are progeny of intercrossing after 9th generations.
acrc:21000336 Sirt4 (-/-) 129-Sirt4tm1Fwa Public Cryo-S Mus Musculus targetted KO Cryo for Ullas Kolthur - TIFRmumbai - JAX JAX#012756 129S1/Sv Tuesday, December 26, 2017 Ullas Kolthur for Cryo Stocks, JAX
acrc:21000335 Sirt6(+/-) 129-Sirt6tm1Fwa Public Cryo-S Mus Musculus Targeted Mutation - LacZ KO Cryo for Ullas Kolthur - TIFRmumbai - JAX JAX#006050 129:B6 Sunday, November 20, 2016 Ullas Kolthur for Cryo Stocks, JAX This mutant mouse strain contains a lacZ gene knock-in resulting in a loss of function of the targeted allele and may be useful in studies of DNA damage repair, genomic stability, and aging.
acrc:21000293 SLICK-H STOCK Tg(Thy1-cre/ERT2,-EYFP)HGfng/PyngJNcbs Public Live, Cryo-S Mus Musculus Transgenic (Recombinase-expressing, Reporter, Inducible) JAX JAX# 12708 mixed: (C57BL/6J ; CBA) - backcrossed to C57BL/6J for 4generations by JAX Hemizygous X sibling non-carriers or Hemizygous X C57BL/6J black Thursday, September 20, 2018 2 hemizygote males JAX
acrc:21000148 Snail fl/fl, K14 Cre Snail fl/fl, K14 Cre Public Live, Cryo-S Mus Musculus CJ
acrc:21000301 Sox10-Cre B6;CBA-Tg(Sox10-cre)1Wdr/JNcbs Public Live, Cryo-S Mus Musculus Transgenic (Recombinase-expressing) JAX ->NCBS JAX# 025807 B6;CBA Noncarrier x Hemizygote OR Hemizygote x Noncarrier black Thursday, September 20, 2018 1 breeding pair (Hemizygoytes) JAX The Jackson Laboratory live colony in 2017 exhibits white belly spots (not linked to presence of the transgene).
acrc:21000250 Sst-IRES-Cre B6N.CgSst<tm2.1(cre)Zjh>/J Public Live, Cryo-S Mus Musculus Targeted (Recombinase-expressing) JAX JAX# 18973 B6N Heterozygote x Wild-type OR Wild-type x Heterozygote or HET X HET Black Wednesday, February 21, 2018 2 (HET X WT) breeding pairs JAX @JAX- Mice were bred to C57BL/6NJ inbred mice (Stock No. 005304) for many generations using a marker-assisted, speed congenic approach to generate this C57BL/6NJ-congenic strain. When maintaining the live congenic colony, homozygous mice may be bred together. Researchers may consider using heterozygous Sst-IRES-Cre mice in behavioral studies; please see strain description for more details. USB
acrc:21000153 Stim1fl/+, tdTAi14/+ Stim1^tm1Rao/Ncbs (= Stim1 Floxed), B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (=tdTomatoAi14) / Ncbs Public Live, Cryo-S Mus Musculus JAX and Anjana Rao compound of JAX# 007914 and MGI:3778911 JAX, Anjana Rao Lab, La Jolla Institute (CA),, Gaiti Hasan GH
acrc:21000427 Tbet-cre B6;CBA-Tg(Tbx21-cre)1Dlc/J [ Tbet-cre ] Public Cryo-S Mus Musculus JAX -> ACRC JAX#024507 Thursday, August 27, 2020 2 sperm straws JAX to TIFRHyd, Adish Dani (TIFR Hyd) Cryo Sperm imported from JAX for Adish Dani on 27 August 2020.
acrc:21000047 TBra B6 x B6Ei.Cg-TWis/EiJNcbs (Brachyury mutant) Public Live, Cryo-S Mus Musculus Congenic Spontaneous Mutation JAX JAX# 004591 (f)TBra(het) x (m)B6D2F1; or (f)B6D2F1 x (m)TBra(het) (C57Bl/6J) Black 8 to 12 pups per litter N Global JAX/NCBS/Instem transfer agreements_2017 RS; phenotyped screening:?
acrc:21000044 Tbx6Cre Tg(Tbx6Cre)rsa/Ncbs Public Live, Cryo-S Mus Musculus Tg RS lab (Pasteur Institute Paris) B6D2 ? Tbx6-Cre X B6D2 F1 Black 8-12 pups per litter Y RS lab (Pasteur Institute Paris) RS different lines- Tbx6Cre#5 Tbx6Cre#4
acrc:21000046 Tbx6YFP Tbx6tm2(HIST1H2BB/EYFP)Pa/Ncbs Public Live, Cryo-S Mus Musculus KO, KI MGI:3798467 ; 043813-JAX (f)Tbx6YFP/+ x (m)B6D2F1 or (f)B6D2F1 x (m)Tbx6YFP/+ Black, grey or coco Y virginia papaioannou, MMRC - JAX RS
acrc:21000045 TCre Tg(TCre)rsa/Ncbs Public Live, Cryo-S Mus Musculus Tg RS lab (MRI) FVB/NJ? Homozygous breeding on FVB/NJ background white 8 to 12 pups per litter Y Ramkumar Sambasivan RS
acrc:21000040 tdTomatoAi14 B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14) Public Live, Cryo-E, Cryo-S Mus Musculus Congenic; Gene Trap; Targeted Mutation JAX JAX# 007914 B6/J Homozygote x Homozygote black 2 breeders Global JAX/NCBS/Instem transfer agreements_2017 MMP, SC, AG, GH, ACRC
acrc:21000199 Thy1-EGFP STOCK Tg(Thy1-EGFP)MJrs/JNcbs [Thy1-GFP line M] Public Live, Cryo-S Mus Musculus Transgenic, Random Insertion JAX stock but imported to NCBS from IISc (Dr. Balaji, CNS) Bangalore - Nov2016 JAX#007788 mixed/unknowm from IISc (initially created on (C57BL/6J x CBA)F1 background recommended: Noncarrier x Hemizygote Saturday, November 12, 2016 rederived from IISc (Dr. Balaji, CNS) colony JAX notes: When maintaining a live colony, hemizygous mice may be bred to wildtype (noncarrier) siblings. The donating investigator suggests that backcrossing these mice onto the C57BL/6 genetic background may lead to breeding difficulties. (Initially wrongly imported and mentioned as from JAX #011070 Thy1-eGFP-S line - )
acrc:21000156 Tie2Cre (Flv) B6.Cg-Tg(Tek-cre)12Flv/JNcbs Public Live, Cryo-S Mus Musculus Congenic, Transgenic (Recombinase-expressing) JAX JAX# 004128 C57BL/6J x Hemizygote OR Hemizygous x C57BL/6J black Y 4 males + 4 females (26-Feb-2009) JAX - NCBS relocation agreements Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000564 Tmem119-CreERT2, E2-2 C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs, Tcf4tm1.1Hmb (E2-2-)/Ncbs Public Live, Cryo-S Mus Musculus Endonuclease-Mediated Mutation, Targeted Mutation JAX and Dan Holmberg (Sweden) JAX# 031820 and MGI:3798811 mixed JAX, Dan Holmberg (Sweden)
acrc:21000085 Twist1 flox Twist1tm2Bhr/Ncbs Public Live, Cryo-S Mus Musculus Targeted (Conditional ready, No functional change) Richard R Behringer MGI:3768516 Richard R Behringer RS
acrc:21000180 Upk3aGCE/+, tdT/+ B6;DBA-Tg(Upk3a-GFP/cre/ERT2)26Amc/J, B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (=tdTomatoAi14) / [Ncbs] Public Live, Cryo-S Mus Musculus double - transgenic,Targeted / compound Boston University / JAX components of JAX# 007914 and JAX# 015855 B6/J & DBA Tuesday, February 16, 2016 2F + 2M Global JAX/NCBS/Instem transfer agreements_2017 AG Compound strain imported from Boston University with JAX relocation agreement
acrc:21000429 V2R-GFP STOCK Vmn2r26tm1Mom/MomJ [ V2r1b-IRES-tauGFP, V2R-GFP ] Public Live, Cryo-S Mus Musculus Targeted (Reporter) JAX -> ACRC JAX#006657 Thursday, August 27, 2020 2 sperm straws JAX to TIFRHyd, Adish Dani (TIFR Hyd) Cryo Sperm imported from JAX for Adish Dani on 27 August 2020. - 2straws received -
acrc:21000272 Vangl2 LPT/LeJNcbs [Vangl2Lp = VANGL planar cell polarity 2 - Loop tail] Public Live, Cryo-S Mus Musculus spontaneous mutation RIKEN-CDB + JAX JAX# 000220??? OR JAX# 013121??? => to clarify by sequencing? mentions CD1 on riken import file??? should be b6J? Monday, January 29, 2018 1 CryoVial (= 63 2-cell embryos) JAX relocation agreement for JAX# 000220 the loop tail mutation of the Vangl2 gene in causing neurodevelopmental defects leading to short, curly tails and spina bifida. There is incomplete penetrance and prenatal and perinatal lethality. Some heterozygous with mild spina bifida survive to adulthood and have bred. Some heterozygous females have closed vaginas. __ JAX Stock#000220 carries a transition point mutation that alters a G to an A at coding nucleotide 1391 (c.1391G>A). This is predicted to alter serine 464 to asparagine (p.S464N) in the encoded protein.Western blot analysis indicates an approximate 80% reduction in protein expression in homozygotes and downward shift in molecular mass that is emulated by dephosphorylation of the wild-type protein. __ JAX stock#013121 is a spontaneous mutation is an A-to-G (T-to-C on forward strand) substitution in the 5' UTR.
acrc:21000385 Vangl2-FLOX B6;129-Vangl2tm2.1Mdea/JNcbs Public Live, Cryo-S Mus Musculus targeted mutation JAX -> ACRC JAX#025174 mixed Wednesday, November 27, 2019 JAX These floxed mutant mice possess loxP sites flanking exons 2 and 3 of the Vangl2 gene. This strain may be useful for generating conditional mutations in applications related to planar cell polarity.
acrc:21000394 Vav-iCre B6N.Cg-Tg(Vav1-icre)A2Kio/JNcbs [Vav-iCre] Public Cryo-S Mus Musculus JNCASR - MI JAX# 018968 Wednesday, January 8, 2020 JAX, Maneesha Inamdar (JNCSAR) Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:23000033 Vglut1-Cre B6;129S-Slc17a7tm1.1(cre)Hze/J Public Cryo-S Mus Musculus Arnab Barik-IISc C57BL/6J 2 males issued for cryopreservation on 9 Apr 2023
acrc:21000381 VGlut3-KO B6;129S2-Slc17a8tm1Edw/JNcbs [VGlut3-KO] Public Cryo-S Mus Musculus Targeted KI Cryo Sperm imported by TIFRHyd- Adish Dani - from Mark Rutherford - also available at JAX JAX#016931 Wednesday, July 10, 2019 3 Cryo sperm straws Adish Dani- TIFR Hyd, JAX 1) Cryo Stocks imported for Adish Dani- TIFR Hyderabad. 2) Stock Cryo-recovered at MGEF via IVF on B6/JNcbs background in September 2019- > transferred to TIFR Hyderabad
acrc:21000251 Wnt1-Cre2 129S4.CgTg(Wnt1cre)2Sor/JNcbs Public Cryo-S Mus Musculus Transgenic +Null/Knockout, (Recombinase-expressing) JAX JAX# 22137 129S4 Hemizygote x Noncarrier OR Noncarrier x Hemizygote agouti @JAX- hemizygous mice may be bred together, to wildtype siblings, or to 129S4/SvJaeJ inbred mice (Stock No. 009104)- BUT take note that homozygotes result in a functional knock-out of E2f1 gene. Wednesday, February 21, 2018 2 (Noncarrier X Hemi) breeding pairs JAX, Ramkumar Sambasivan @JAX- The transgene integrated into chromosome 2 causing a 257 bp deletion and a 45 Kb inverted segment in exon 5 of the E2f1 (E2F transcription factor 1) gene. The inversion contains all of exon 5, but deletes 23 Kb including exons 6 and 7. The deletion results in a functional knock-out of E2f1 in homozygous mice. RS
acrc:21000490 αMHC-MerCreMer B6.FVB(129)-A1cfTg(Myh6-cre/Esr1*)1Jmk/JNcbs [αMHC-MerCreMer] Public Live, Cryo-S Mus Musculus Congenic, Transgenic JAX -> NCBS JAX# 005657 Thursday, April 15, 2021 2 males JAX The alpha-MHC-MerCreMer (αMHC-MerCreMer) transgene has the mouse cardiac-specific alpha-myosin heavy chain promoter (αMHC or alpha-MHC; Myh6) directing expression of a tamoxifen-inducible Cre recombinase (MerCreMer) to juvenile and adult cardiac myocytes. -- The MerCreMer double fusion protein has substantially greater Cre recombinase activity with less promiscuity compared with the CreMer single fusion protein.